Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009806.1

Orthogroup ID

OG0003957

Physical Location & Seq

Genomic Coordinates Forward (+)

46683 .. 47417

Gene Structure 735 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009806.1_g000018.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 288 bp

ctgggtcttcctattctgggttattctctagatattgggaaagagcatgtaaatctcattgatcaaaggctggaaaagctgatatacagtgggcagcttgatgcaaaggaactagacaggttggctgcggtagcaatggctggactcgcagcagaaggtctgaagtatgacaaagtgattggtcaatctgctgatctcttcactcttcagagatttatcaacagaagcaagccacagcttagcaaagatcagcaacaaaatcttactagatgggctgtaaatgactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

95

Amino Acids

10.61

Weight (kDa)

6.79

Isoelectric Point (pI)

32.32

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003957)

Species	Orthologous Gene IDs
malus_domestica	MD10G1272900.v1.1 MD12G1047700.v1.1
prunus_persica	Prupe.6G173100_v2.0.a1
rosa_chinensis	RchiOBHm_Chr4g0416901
rosa_laevigata	RLG00000010244 RLG00000014520 RLG00000034064
rosa_multiflora	Rmu_sc0000841.1_g000007 Rmu_sc0002944.1_g000034 Rmu_sc0005261.1_g000002 Rmu_sc0006888.1_g000053 Rmu_sc0009806.1_g000018 Rmu_sc0010720.1_g000010 Rmu_sc0011203.1_g000008 Rmu_sc0013694.1_g000001
rosa_roxburghii	Rroxscaffold_5G00339470
rosa_rugosa	Rorug04G0098200
rosa_samantha	Rh1AG100000 Rh1AG281200 Rh2BG194100 Rh2BG303100 Rh2CG528100 Rh3BG230300 Rh4CG169100 Rh5BG217900 Rh5BG457200 Rh5BG457300 Rh5CG335600 Rh5CG336000 Rh5CG479300 Rh6CG220900 Rh7CG245800 Rh7CG344000
rosa_wichuraiana	Rw1G019930

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	128
AcuI	CTGAAG	2 cut(s)	182, 191
AfiI	CCNNNNNNNGG	1 cut(s)	17
AluBI	AGCT	3 cut(s)	79, 97, 238
AluI	AGCT	3 cut(s)	79, 97, 238
ApeKI	GCWGC	3 cut(s)	94, 125, 149
BbvI	GCAGC	3 cut(s)	106, 112, 161
BccI	CCATC	1 cut(s)	264
BclI	TGATCA	1 cut(s)	61
BfaI	CTAG	3 cut(s)	29, 113, 267
BisI	GCNGC	3 cut(s)	95, 126, 150
BlpI	GCTNAGC	1 cut(s)	239
BlsI	GCNGC	3 cut(s)	96, 127, 151
BmsI	GCATC	1 cut(s)	91
Bpu1102I	GCTNAGC	1 cut(s)	239
Bsc4I	CCNNNNNNNGG	1 cut(s)	17
Bse3DI	GCAATG	1 cut(s)	141
BseLI	CCNNNNNNNGG	1 cut(s)	17
BseMI	GCAATG	1 cut(s)	141
BseXI	GCAGC	3 cut(s)	106, 112, 161
BslI	CCNNNNNNNGG	1 cut(s)	17
Bsp143I	GATC	3 cut(s)	61, 193, 247
Bsp1720I	GCTNAGC	1 cut(s)	239
BspACI	CCGC	1 cut(s)	128
BsrDI	GCAATG	1 cut(s)	141
BssMI	GATC	3 cut(s)	61, 193, 247
Bst4CI	ACNGT	1 cut(s)	89
Bst6I	CTCTTC	2 cut(s)	203, 210
BstC8I	GCNNGC	1 cut(s)	230
BstDEI	CTNAG	1 cut(s)	239
BstKTI	GATC	3 cut(s)	64, 196, 250
BstMBI	GATC	3 cut(s)	61, 193, 247
BstMWI	GCNNNNNNNGC	3 cut(s)	76, 131, 146
BstNSI	RCATGY	1 cut(s)	50
BstV1I	GCAGC	3 cut(s)	106, 112, 161
BtsIMutI	CAGTG	1 cut(s)	94
Cac8I	GCNNGC	1 cut(s)	230
CviAII	CATG	1 cut(s)	47
CviJI	RGCY	8 cut(s)	70, 79, 97, 125, 140, 232, 238, 275
CviKI_1	RGCY	8 cut(s)	70, 79, 97, 125, 140, 232, 238, 275
DdeI	CTNAG	1 cut(s)	239
DpnI	GATC	3 cut(s)	63, 195, 249
DpnII	GATC	3 cut(s)	61, 193, 247
Eam1104I	CTCTTC	2 cut(s)	203, 210
EarI	CTCTTC	2 cut(s)	203, 210
Eco57I	CTGAAG	2 cut(s)	182, 191
FaeI	CATG	1 cut(s)	50
FaiI	YATR	3 cut(s)	48, 85, 168
FatI	CATG	1 cut(s)	46
FbaI	TGATCA	1 cut(s)	61
Fnu4HI	GCNGC	3 cut(s)	95, 126, 150
Fsp4HI	GCNGC	3 cut(s)	95, 126, 150
FspBI	CTAG	3 cut(s)	29, 113, 267
GluI	GCNGC	3 cut(s)	95, 126, 150
Hin1II	CATG	1 cut(s)	50
HinfI	GANTC	1 cut(s)	144
Hpy188I	TCNGA	2 cut(s)	162, 210
Hpy188III	TCNNGA	1 cut(s)	29
HpyAV	CCTTC	1 cut(s)	149
HpyCH4III	ACNGT	1 cut(s)	89
HpyCH4V	TGCA	1 cut(s)	104
HpyF10VI	GCNNNNNNNGC	3 cut(s)	76, 131, 146
HpyF3I	CTNAG	1 cut(s)	239
Hsp92II	CATG	1 cut(s)	50
Ksp22I	TGATCA	1 cut(s)	61
Kzo9I	GATC	3 cut(s)	61, 193, 247
LpnPI	CCDG	4 cut(s)	2, 56, 103, 126
Lsp1109I	GCAGC	3 cut(s)	106, 112, 161
LweI	GCATC	1 cut(s)	91
MaeI	CTAG	3 cut(s)	29, 113, 267
MalI	GATC	3 cut(s)	63, 195, 249
MboI	GATC	3 cut(s)	61, 193, 247
MboII	GAAGA	2 cut(s)	190, 197
MlyI	GAGTC	1 cut(s)	138
MwoI	GCNNNNNNNGC	3 cut(s)	76, 131, 146
NdeII	GATC	3 cut(s)	61, 193, 247
NlaIII	CATG	1 cut(s)	50
NspI	RCATGY	1 cut(s)	50
PkrI	GCNGC	3 cut(s)	96, 127, 151
PleI	GAGTC	1 cut(s)	138
PpsI	GAGTC	1 cut(s)	138
SatI	GCNGC	3 cut(s)	95, 126, 150
Sau3AI	GATC	3 cut(s)	61, 193, 247
SchI	GAGTC	1 cut(s)	138
SetI	ASST	5 cut(s)	81, 99, 122, 160, 240
SfaNI	GCATC	1 cut(s)	91
SsiI	CCGC	1 cut(s)	128
SspMI	CTAG	3 cut(s)	29, 113, 267
TaaI	ACNGT	1 cut(s)	89
TscAI	CASTG	1 cut(s)	94
TseI	GCWGC	3 cut(s)	94, 125, 149
TspRI	CASTG	1 cut(s)	94
XbaI	TCTAGA	1 cut(s)	28
XceI	RCATGY	1 cut(s)	50
XspI	CTAG	3 cut(s)	29, 113, 267

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.