Rh1AG281200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
51023935 .. 51024171
237 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG281200.1

Sequence Viewer

Length: 153 bp
ATGGCTGGACTCGCAGCAGAAGGTCTGAAGTATGACAAATTGATTGGTCAATCTGCTGATCTCTTCACTCTTCAGAGATTTATCAACAGAAGCAAGCCACAACTTAGCAAAGATCAGCAACAAAATCTTACTAGATGGGCTGTAAATGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.68

Weight (kDa)

9.4

Isoelectric Point (pI)

52.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 47, 56
ApeKI GCWGC 1 cut(s) 14
BbvI GCAGC 1 cut(s) 26
BccI CCATC 1 cut(s) 129
BfaI CTAG 1 cut(s) 132
BisI GCNGC 1 cut(s) 15
BlsI GCNGC 1 cut(s) 16
BseXI GCAGC 1 cut(s) 26
Bsp143I GATC 2 cut(s) 58, 112
BssMI GATC 2 cut(s) 58, 112
Bst6I CTCTTC 2 cut(s) 68, 75
BstC8I GCNNGC 1 cut(s) 95
BstDEI CTNAG 1 cut(s) 104
BstKTI GATC 2 cut(s) 61, 115
BstMBI GATC 2 cut(s) 58, 112
BstMWI GCNNNNNNNGC 1 cut(s) 11
BstV1I GCAGC 1 cut(s) 26
Cac8I GCNNGC 1 cut(s) 95
CviJI RGCY 3 cut(s) 5, 97, 140
CviKI_1 RGCY 3 cut(s) 5, 97, 140
DdeI CTNAG 1 cut(s) 104
DpnI GATC 2 cut(s) 60, 114
DpnII GATC 2 cut(s) 58, 112
Eam1104I CTCTTC 2 cut(s) 68, 75
EarI CTCTTC 2 cut(s) 68, 75
Eco57I CTGAAG 2 cut(s) 47, 56
FaiI YATR 1 cut(s) 33
Fnu4HI GCNGC 1 cut(s) 15
Fsp4HI GCNGC 1 cut(s) 15
FspBI CTAG 1 cut(s) 132
FspEI CC 5 cut(s) 6, 30, 111, 121, 122
GluI GCNGC 1 cut(s) 15
HinfI GANTC 1 cut(s) 9
Hpy188I TCNGA 2 cut(s) 27, 75
HpyAV CCTTC 1 cut(s) 14
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
HpyF3I CTNAG 1 cut(s) 104
Kzo9I GATC 2 cut(s) 58, 112
Lsp1109I GCAGC 1 cut(s) 26
MaeI CTAG 1 cut(s) 132
MalI GATC 2 cut(s) 60, 114
MboI GATC 2 cut(s) 58, 112
MboII GAAGA 2 cut(s) 55, 62
MluCI AATT 1 cut(s) 38
MlyI GAGTC 1 cut(s) 3
MwoI GCNNNNNNNGC 1 cut(s) 11
NdeII GATC 2 cut(s) 58, 112
PkrI GCNGC 1 cut(s) 16
PleI GAGTC 1 cut(s) 3
PpsI GAGTC 1 cut(s) 3
SatI GCNGC 1 cut(s) 15
Sau3AI GATC 2 cut(s) 58, 112
SchI GAGTC 1 cut(s) 3
SetI ASST 1 cut(s) 25
SgeI CNNG 4 cut(s) 18, 23, 106, 144
Sse9I AATT 1 cut(s) 38
SspMI CTAG 1 cut(s) 132
TasI AATT 1 cut(s) 38
TseI GCWGC 1 cut(s) 14
XspI CTAG 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.