RchiOBHm_Chr4g0442591

Transmembrane protein 205

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
64086039 .. 64086221
183 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ41033

Sequence Viewer

Length: 183 bp
ATGTCACCAATCTGTTCGTCTTCAGTCTTAACACTCATGACTATTGAGATGATGAAGCTGAGGCATAAGGTAGAGAGGAAACGGAACATTGGGGAAGAATTGGGATGGTCCAAAAATGAGGAAGATGATATAGAAGTTAAGGGTAAATTAGGAATTTCAATAGCTAAGGAGTGTGGTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

6.76

Weight (kDa)

6.56

Isoelectric Point (pI)

83.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 153
AcuI CTGAAG 1 cut(s) 6
AgsI TTSAA 1 cut(s) 159
AluBI AGCT 2 cut(s) 58, 164
AluI AGCT 2 cut(s) 58, 164
ApoI RAATTY 1 cut(s) 153
AspS9I GGNCC 1 cut(s) 108
AvaII GGWCC 1 cut(s) 108
BbsI GAAGAC 1 cut(s) 12
BbvCI CCTCAGC 1 cut(s) 59
BccI CCATC 1 cut(s) 99
Bme18I GGWCC 1 cut(s) 108
BmgT120I GGNCC 1 cut(s) 108
BpiI GAAGAC 1 cut(s) 12
Bpu10I CCTNAGC 2 cut(s) 59, 165
BseGI GGATG 1 cut(s) 110
BseMII CTCAG 1 cut(s) 50
BspCNI CTCAG 1 cut(s) 51
BspHI TCATGA 1 cut(s) 36
BstDEI CTNAG 2 cut(s) 59, 165
BstF5I GGATG 1 cut(s) 110
BstV2I GAAGAC 1 cut(s) 12
BtsCI GGATG 1 cut(s) 110
CciI TCATGA 1 cut(s) 36
Cfr13I GGNCC 1 cut(s) 108
CviAII CATG 1 cut(s) 37
CviJI RGCY 2 cut(s) 58, 164
CviKI_1 RGCY 2 cut(s) 58, 164
DdeI CTNAG 2 cut(s) 59, 165
Eco47I GGWCC 1 cut(s) 108
Eco57I CTGAAG 1 cut(s) 6
FaeI CATG 1 cut(s) 40
FaiI YATR 3 cut(s) 38, 66, 131
FatI CATG 1 cut(s) 36
FokI GGATG 1 cut(s) 117
Hin1II CATG 1 cut(s) 40
Hpy188III TCNNGA 1 cut(s) 37
HpyF3I CTNAG 2 cut(s) 59, 165
Hsp92II CATG 1 cut(s) 40
MaeIII GTNAC 1 cut(s) 3
MboII GAAGA 3 cut(s) 12, 107, 134
MluCI AATT 3 cut(s) 98, 146, 153
MnlI CCTC 3 cut(s) 54, 69, 112
MseI TTAA 2 cut(s) 29, 138
NlaIII CATG 1 cut(s) 40
NmuCI GTSAC 1 cut(s) 3
PagI TCATGA 1 cut(s) 36
PspPI GGNCC 1 cut(s) 108
SaqAI TTAA 2 cut(s) 29, 138
Sau96I GGNCC 1 cut(s) 108
SetI ASST 3 cut(s) 60, 72, 166
SgeI CNNG 1 cut(s) 49
SinI GGWCC 1 cut(s) 108
Sse9I AATT 3 cut(s) 98, 146, 153
TasI AATT 3 cut(s) 98, 146, 153
Tru1I TTAA 2 cut(s) 29, 138
Tru9I TTAA 2 cut(s) 29, 138
TseFI GTSAC 1 cut(s) 3
Tsp45I GTSAC 1 cut(s) 3
TspDTI ATGAA 1 cut(s) 68
TspGWI ACGGA 1 cut(s) 97
VpaK11BI GGWCC 1 cut(s) 108
XapI RAATTY 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.