RchiOBHm_Chr5g0039051

Transmembrane protein 205

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0003018
Physical Location & Seq
Reverse (-)
33795683 .. 33795937
255 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31763

Sequence Viewer

Length: 255 bp
ATGTTCAAGAATCTTCTGAGGCATCAGTTCGGTAATCTGCAAAGCAAGATGTTTCCAGCTTATTTCACCATGGTGGGGATTTGTTGTGCCATATCGGTGGCTTCGTTTGGGTATTTGCATCCATGGAACTCTTCCACTGTAGCAGACAAGTACCAGCTCGGCTTTTTGCTTTCTTCCTTCTCCTTTAATCTCACCAATTTGTTCGTCTTCACTCCCATGACTGTTGAGATGATGAAGCATAGGCATATAAGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4149

Protein Analysis

84

Amino Acids

9.75

Weight (kDa)

9.7

Isoelectric Point (pI)

32.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF4149 PF13664 1 - 82 4.5e-20 Domain of unknown function (DUF4149)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 152
AfiI CCNNNNNNNGG 1 cut(s) 75
AgsI TTSAA 1 cut(s) 7
AleI CACNNNNGTG 1 cut(s) 71
AluBI AGCT 2 cut(s) 59, 157
AluI AGCT 2 cut(s) 59, 157
AsuHPI GGTGA 2 cut(s) 58, 184
BbsI GAAGAC 1 cut(s) 199
BfmI CTRYAG 1 cut(s) 138
BmsI GCATC 2 cut(s) 31, 127
BpiI GAAGAC 1 cut(s) 199
BsaJI CCNNGG 2 cut(s) 69, 122
Bsc4I CCNNNNNNNGG 1 cut(s) 75
BseDI CCNNGG 2 cut(s) 69, 122
BseGI GGATG 1 cut(s) 118
BseLI CCNNNNNNNGG 1 cut(s) 75
BseMII CTCAG 1 cut(s) 8
BslI CCNNNNNNNGG 1 cut(s) 75
Bsp19I CCATGG 2 cut(s) 69, 122
BspCNI CTCAG 1 cut(s) 9
BssECI CCNNGG 2 cut(s) 69, 122
BssT1I CCWWGG 2 cut(s) 69, 122
Bst4CI ACNGT 2 cut(s) 139, 223
Bst6I CTCTTC 1 cut(s) 136
BstDEI CTNAG 1 cut(s) 17
BstDSI CCRYGG 2 cut(s) 69, 122
BstF5I GGATG 1 cut(s) 118
BstSFI CTRYAG 1 cut(s) 138
BstV2I GAAGAC 1 cut(s) 199
BstXI CCANNNNNNTGG 1 cut(s) 97
BtgI CCRYGG 2 cut(s) 69, 122
BtsCI GGATG 1 cut(s) 118
BtsIMutI CAGTG 1 cut(s) 135
Csp6I GTAC 1 cut(s) 151
CviAII CATG 3 cut(s) 70, 123, 217
CviJI RGCY 4 cut(s) 59, 101, 157, 162
CviKI_1 RGCY 4 cut(s) 59, 101, 157, 162
CviQI GTAC 1 cut(s) 151
DdeI CTNAG 1 cut(s) 17
Eam1104I CTCTTC 1 cut(s) 136
EarI CTCTTC 1 cut(s) 136
Eco130I CCWWGG 2 cut(s) 69, 122
EcoT14I CCWWGG 2 cut(s) 69, 122
ErhI CCWWGG 2 cut(s) 69, 122
FaeI CATG 3 cut(s) 73, 126, 220
FaiI YATR 7 cut(s) 71, 92, 124, 218, 240, 246, 248
FatI CATG 3 cut(s) 69, 122, 216
FokI GGATG 1 cut(s) 105
Hin1II CATG 3 cut(s) 73, 126, 220
HinfI GANTC 1 cut(s) 10
HphI GGTGA 2 cut(s) 58, 184
Hpy188I TCNGA 1 cut(s) 18
Hpy188III TCNNGA 1 cut(s) 7
HpyAV CCTTC 1 cut(s) 187
HpyCH4III ACNGT 2 cut(s) 139, 223
HpyCH4V TGCA 2 cut(s) 40, 118
HpyF3I CTNAG 1 cut(s) 17
Hsp92II CATG 3 cut(s) 73, 126, 220
LpnPI CCDG 2 cut(s) 69, 167
LweI GCATC 2 cut(s) 31, 127
MboII GAAGA 4 cut(s) 5, 123, 165, 199
MluCI AATT 1 cut(s) 196
MnlI CCTC 1 cut(s) 12
MseI TTAA 1 cut(s) 186
MslI CAYNNNNRTG 3 cut(s) 71, 95, 215
NcoI CCATGG 2 cut(s) 69, 122
NlaIII CATG 3 cut(s) 73, 126, 220
NmeAIII GCCGAG 1 cut(s) 138
OliI CACNNNNGTG 1 cut(s) 71
PcsI WCGNNNNNNNCGW 1 cut(s) 101
PfeI GAWTC 1 cut(s) 10
RsaI GTAC 1 cut(s) 152
RsaNI GTAC 1 cut(s) 151
RseI CAYNNNNRTG 3 cut(s) 71, 95, 215
SaqAI TTAA 1 cut(s) 186
SetI ASST 3 cut(s) 61, 159, 254
SfaNI GCATC 2 cut(s) 31, 127
SfcI CTRYAG 1 cut(s) 138
SgeI CNNG 9 cut(s) 19, 58, 68, 82, 135, 160, 166, 170, 229
SmiMI CAYNNNNRTG 3 cut(s) 71, 95, 215
Sse9I AATT 1 cut(s) 196
StyI CCWWGG 2 cut(s) 69, 122
TaaI ACNGT 2 cut(s) 139, 223
TasI AATT 1 cut(s) 196
TfiI GAWTC 1 cut(s) 10
Tru1I TTAA 1 cut(s) 186
Tru9I TTAA 1 cut(s) 186
TscAI CASTG 1 cut(s) 142
TspDTI ATGAA 1 cut(s) 248
TspRI CASTG 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.