Rh2AG433100

Transmembrane protein 205

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0003018
Physical Location & Seq
Reverse (-)
64322070 .. 64322270
201 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG433100.1

Sequence Viewer

Length: 201 bp
ATGGTGGGAATTTGTTGTGCGATATCACTAGCTTCATTTGGGTACTTGCATCCATGGAACTCTTCCACTTTGGCAGACAAGCACTGGCTCGGCTTTTTGCTTGCTTCCCTGGCCTTCAATCTCACCAATTTGTTCATCTTCAAGCCTATGAATATTGAGATGATGAAGCAAAGGCATAAGGTAAAGGAAATAGAACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4149

Protein Analysis

66

Amino Acids

7.59

Weight (kDa)

8.74

Isoelectric Point (pI)

31.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF4149 PF13664 3 - 60 4.4e-07 Domain of unknown function (DUF4149)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 9
AfaI GTAC 1 cut(s) 44
AgsI TTSAA 2 cut(s) 118, 142
AjnI CCWGG 1 cut(s) 108
AluBI AGCT 1 cut(s) 32
AluI AGCT 1 cut(s) 32
AoxI GGCC 1 cut(s) 111
ApoI RAATTY 1 cut(s) 9
AsuHPI GGTGA 1 cut(s) 115
BciT130I CCWGG 1 cut(s) 110
BfaI CTAG 1 cut(s) 29
Bme1390I CCNGG 1 cut(s) 110
BmrFI CCNGG 1 cut(s) 110
BmsI GCATC 1 cut(s) 58
BsaJI CCNNGG 2 cut(s) 53, 108
Bse1I ACTGG 1 cut(s) 89
BseBI CCWGG 1 cut(s) 110
BseDI CCNNGG 2 cut(s) 53, 108
BseGI GGATG 1 cut(s) 49
BseNI ACTGG 1 cut(s) 89
BshFI GGCC 1 cut(s) 113
BsnI GGCC 1 cut(s) 113
Bsp19I CCATGG 1 cut(s) 53
BspANI GGCC 1 cut(s) 113
BsrI ACTGG 1 cut(s) 89
BssECI CCNNGG 2 cut(s) 53, 108
BssT1I CCWWGG 1 cut(s) 53
Bst2UI CCWGG 1 cut(s) 110
Bst6I CTCTTC 1 cut(s) 67
BstC8I GCNNGC 1 cut(s) 102
BstDSI CCRYGG 1 cut(s) 53
BstF5I GGATG 1 cut(s) 49
BstMWI GCNNNNNNNGC 1 cut(s) 110
BstNI CCWGG 1 cut(s) 110
BstSCI CCNGG 1 cut(s) 108
BsuRI GGCC 1 cut(s) 113
BtgI CCRYGG 1 cut(s) 53
BtsCI GGATG 1 cut(s) 49
BtsIMutI CAGTG 1 cut(s) 82
Cac8I GCNNGC 1 cut(s) 102
Csp6I GTAC 1 cut(s) 43
CviAII CATG 1 cut(s) 54
CviJI RGCY 5 cut(s) 32, 88, 93, 113, 145
CviKI_1 RGCY 5 cut(s) 32, 88, 93, 113, 145
CviQI GTAC 1 cut(s) 43
Eam1104I CTCTTC 1 cut(s) 67
EarI CTCTTC 1 cut(s) 67
Eco130I CCWWGG 1 cut(s) 53
Eco32I GATATC 1 cut(s) 24
EcoRII CCWGG 1 cut(s) 108
EcoRV GATATC 1 cut(s) 24
EcoT14I CCWWGG 1 cut(s) 53
ErhI CCWWGG 1 cut(s) 53
FaeI CATG 1 cut(s) 57
FaiI YATR 3 cut(s) 55, 149, 177
FatI CATG 1 cut(s) 53
FokI GGATG 1 cut(s) 36
FspBI CTAG 1 cut(s) 29
HaeIII GGCC 1 cut(s) 113
Hin1II CATG 1 cut(s) 57
HphI GGTGA 1 cut(s) 115
HpyAV CCTTC 1 cut(s) 124
HpyCH4V TGCA 1 cut(s) 49
HpyF10VI GCNNNNNNNGC 1 cut(s) 110
Hsp92II CATG 1 cut(s) 57
LpnPI CCDG 3 cut(s) 70, 95, 122
LweI GCATC 1 cut(s) 58
MaeI CTAG 1 cut(s) 29
MboII GAAGA 2 cut(s) 54, 130
MluCI AATT 2 cut(s) 9, 127
MspR9I CCNGG 1 cut(s) 110
MvaI CCWGG 1 cut(s) 110
MwoI GCNNNNNNNGC 1 cut(s) 110
NcoI CCATGG 1 cut(s) 53
NlaIII CATG 1 cut(s) 57
NmeAIII GCCGAG 1 cut(s) 69
Psp6I CCWGG 1 cut(s) 108
PspGI CCWGG 1 cut(s) 108
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
ScrFI CCNGG 1 cut(s) 110
SetI ASST 2 cut(s) 34, 183
SfaNI GCATC 1 cut(s) 58
Sse9I AATT 2 cut(s) 9, 127
SspI AATATT 1 cut(s) 154
SspMI CTAG 1 cut(s) 29
StyD4I CCNGG 1 cut(s) 108
StyI CCWWGG 1 cut(s) 53
TasI AATT 2 cut(s) 9, 127
TscAI CASTG 1 cut(s) 89
TspDTI ATGAA 4 cut(s) 24, 124, 164, 179
TspRI CASTG 1 cut(s) 89
XapI RAATTY 1 cut(s) 9
XspI CTAG 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.