Rroxscaffold_7G00215870

Transmembrane protein 205

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
66413347 .. 66417585
4239 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00215870.1

Sequence Viewer

Length: 150 bp
ATGATGAAGCAGAGGCATAAGATTGAGAGGGAACAGAACATTGGGGAAGAAGTTGGATGGTCCAAAAATGTGAAAGTTGCAAAGGACACGAATTCTGGAATTCAGGACAAGGAACTTGCTTCTATGATTGAGAGTGTTTCCGAGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.62

Weight (kDa)

6.56

Isoelectric Point (pI)

57.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 91, 99
AjuI GAANNNNNNNTTGG 2 cut(s) 24, 56
ApoI RAATTY 2 cut(s) 91, 99
AspS9I GGNCC 1 cut(s) 60
AvaII GGWCC 1 cut(s) 60
BccI CCATC 1 cut(s) 51
Bme18I GGWCC 1 cut(s) 60
BmgT120I GGNCC 1 cut(s) 60
BseGI GGATG 1 cut(s) 62
BstF5I GGATG 1 cut(s) 62
BtsCI GGATG 1 cut(s) 62
Cfr13I GGNCC 1 cut(s) 60
Eco47I GGWCC 1 cut(s) 60
EcoRI GAATTC 2 cut(s) 91, 99
FaiI YATR 2 cut(s) 18, 125
FokI GGATG 1 cut(s) 69
Hpy188I TCNGA 1 cut(s) 142
Hpy188III TCNNGA 2 cut(s) 96, 104
HpyCH4V TGCA 1 cut(s) 80
LpnPI CCDG 2 cut(s) 81, 89
MboII GAAGA 1 cut(s) 59
MluCI AATT 2 cut(s) 91, 99
MmeI TCCRAC 1 cut(s) 34
MnlI CCTC 2 cut(s) 6, 21
PspPI GGNCC 1 cut(s) 60
Sau96I GGNCC 1 cut(s) 60
SgeI CNNG 5 cut(s) 100, 108, 116, 121, 128
SinI GGWCC 1 cut(s) 60
Sse9I AATT 2 cut(s) 91, 99
TasI AATT 2 cut(s) 91, 99
TspDTI ATGAA 1 cut(s) 20
VpaK11BI GGWCC 1 cut(s) 60
XapI RAATTY 2 cut(s) 91, 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.