RchiOBHm_Chr7g0230901

Transmembrane protein 205

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0003018
Physical Location & Seq
Reverse (-)
54535834 .. 54536004
171 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20689

Sequence Viewer

Length: 171 bp
ATGGTGGGAATTTTTTGTGCGATAATTATAGCTTCATTTGGGTATTTGCATCCATGGAACTCTTCCACTTTGGCAGACAAGTACTGGCTCGGCTTTTTGCTTGCTTCCTTGGCCTCCAATCTCACCAATTTGTTTGTCTTCACGCCCATGAATATTGAGATGATGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4149

Protein Analysis

56

Amino Acids

6.3

Weight (kDa)

6.5

Isoelectric Point (pI)

18.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF4149 PF13664 2 - 56 6.6e-06 Domain of unknown function (DUF4149)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 9
AfaI GTAC 1 cut(s) 83
AluBI AGCT 1 cut(s) 32
AluI AGCT 1 cut(s) 32
AoxI GGCC 1 cut(s) 111
ApoI RAATTY 1 cut(s) 9
AsuHPI GGTGA 1 cut(s) 115
BbsI GAAGAC 1 cut(s) 130
BmcAI AGTACT 1 cut(s) 83
BmsI GCATC 1 cut(s) 58
BpiI GAAGAC 1 cut(s) 130
BsaJI CCNNGG 2 cut(s) 53, 108
Bse1I ACTGG 1 cut(s) 89
BseDI CCNNGG 2 cut(s) 53, 108
BseGI GGATG 1 cut(s) 49
BseNI ACTGG 1 cut(s) 89
BshFI GGCC 1 cut(s) 113
BsnI GGCC 1 cut(s) 113
Bsp19I CCATGG 1 cut(s) 53
BspANI GGCC 1 cut(s) 113
BsrI ACTGG 1 cut(s) 89
BssECI CCNNGG 2 cut(s) 53, 108
BssT1I CCWWGG 2 cut(s) 53, 108
Bst6I CTCTTC 1 cut(s) 67
BstC8I GCNNGC 1 cut(s) 102
BstDSI CCRYGG 1 cut(s) 53
BstF5I GGATG 1 cut(s) 49
BstMWI GCNNNNNNNGC 1 cut(s) 110
BstV2I GAAGAC 1 cut(s) 130
BsuRI GGCC 1 cut(s) 113
BtgI CCRYGG 1 cut(s) 53
BtsCI GGATG 1 cut(s) 49
Cac8I GCNNGC 1 cut(s) 102
Csp6I GTAC 1 cut(s) 82
CviAII CATG 2 cut(s) 54, 148
CviJI RGCY 4 cut(s) 32, 88, 93, 113
CviKI_1 RGCY 4 cut(s) 32, 88, 93, 113
CviQI GTAC 1 cut(s) 82
Eam1104I CTCTTC 1 cut(s) 67
EarI CTCTTC 1 cut(s) 67
Eco130I CCWWGG 2 cut(s) 53, 108
EcoT14I CCWWGG 2 cut(s) 53, 108
ErhI CCWWGG 2 cut(s) 53, 108
FaeI CATG 2 cut(s) 57, 151
FaiI YATR 3 cut(s) 29, 55, 149
FatI CATG 2 cut(s) 53, 147
FokI GGATG 1 cut(s) 36
HaeIII GGCC 1 cut(s) 113
Hin1II CATG 2 cut(s) 57, 151
HphI GGTGA 1 cut(s) 115
HpyCH4V TGCA 1 cut(s) 49
HpyF10VI GCNNNNNNNGC 1 cut(s) 110
Hsp92II CATG 2 cut(s) 57, 151
LpnPI CCDG 1 cut(s) 70
LweI GCATC 1 cut(s) 58
MboII GAAGA 2 cut(s) 54, 130
MluCI AATT 3 cut(s) 9, 24, 127
MnlI CCTC 1 cut(s) 124
MslI CAYNNNNRTG 1 cut(s) 146
MwoI GCNNNNNNNGC 1 cut(s) 110
NcoI CCATGG 1 cut(s) 53
NlaIII CATG 2 cut(s) 57, 151
NmeAIII GCCGAG 1 cut(s) 69
RsaI GTAC 1 cut(s) 83
RsaNI GTAC 1 cut(s) 82
RseI CAYNNNNRTG 1 cut(s) 146
ScaI AGTACT 1 cut(s) 83
SetI ASST 1 cut(s) 34
SfaNI GCATC 1 cut(s) 58
SgeI CNNG 8 cut(s) 66, 91, 97, 101, 113, 121, 154, 160
SmiMI CAYNNNNRTG 1 cut(s) 146
Sse9I AATT 3 cut(s) 9, 24, 127
SspI AATATT 1 cut(s) 154
StyI CCWWGG 2 cut(s) 53, 108
TasI AATT 3 cut(s) 9, 24, 127
TatI WGTACW 1 cut(s) 81
TspDTI ATGAA 2 cut(s) 24, 164
XapI RAATTY 1 cut(s) 9
ZrmI AGTACT 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.