Rmu_sc0000851.1_g000004

Transmembrane protein 205

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000851.1
Physical Location & Seq
Forward (+)
12562 .. 13250
689 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000851.1_g000004.1.cds

Sequence Viewer

Length: 345 bp
atggaactcttccagtgtagcagacaagtaccaacttggctttttgctttcaatctcaccaatttgttcgtcttcacacccatgactattgagatattgaagaaatggcataaggtagagagggaacagaatattggggaagaagtgggatggtccaaaaatgtgcaagttgcgaaggtgaacccaaaactagcagccatgaataagaagttcgggatgattcacgggttactatctcttgccgatattatggctttagcagccttgccatgcactcatgatacttggcagatagatggaaggggacacagttcacaagaagagggaaagagagaagacaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

13.06

Weight (kDa)

7.82

Isoelectric Point (pI)

40.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 30
AgsI TTSAA 2 cut(s) 52, 100
AjuI GAANNNNNNNTTGG 2 cut(s) 117, 149
ApeKI GCWGC 2 cut(s) 194, 260
AspS9I GGNCC 1 cut(s) 153
AsuHPI GGTGA 2 cut(s) 49, 190
AvaII GGWCC 1 cut(s) 153
BbsI GAAGAC 1 cut(s) 64
BbvI GCAGC 2 cut(s) 206, 272
BccI CCATC 2 cut(s) 144, 290
BfaI CTAG 1 cut(s) 191
BisI GCNGC 2 cut(s) 195, 261
BlsI GCNGC 2 cut(s) 196, 262
Bme18I GGWCC 1 cut(s) 153
BmgT120I GGNCC 1 cut(s) 153
BpiI GAAGAC 1 cut(s) 64
Bse1I ACTGG 1 cut(s) 13
BseGI GGATG 2 cut(s) 155, 222
BseNI ACTGG 1 cut(s) 13
BseXI GCAGC 2 cut(s) 206, 272
BslFI GGGAC 1 cut(s) 318
BsmFI GGGAC 1 cut(s) 318
BspHI TCATGA 1 cut(s) 277
BsrI ACTGG 1 cut(s) 13
Bst4CI ACNGT 1 cut(s) 311
Bst6I CTCTTC 2 cut(s) 14, 315
BstF5I GGATG 2 cut(s) 155, 222
BstMWI GCNNNNNNNGC 1 cut(s) 260
BstV1I GCAGC 2 cut(s) 206, 272
BstV2I GAAGAC 1 cut(s) 64
BtsCI GGATG 2 cut(s) 155, 222
BtsIMutI CAGTG 1 cut(s) 20
CciI TCATGA 1 cut(s) 277
Cfr13I GGNCC 1 cut(s) 153
Csp6I GTAC 1 cut(s) 29
CviAII CATG 4 cut(s) 82, 199, 270, 278
CviJI RGCY 4 cut(s) 40, 197, 254, 263
CviKI_1 RGCY 4 cut(s) 40, 197, 254, 263
CviQI GTAC 1 cut(s) 29
Eam1104I CTCTTC 2 cut(s) 14, 315
EarI CTCTTC 2 cut(s) 14, 315
Eco47I GGWCC 1 cut(s) 153
FaeI CATG 4 cut(s) 85, 202, 273, 281
FaiI YATR 6 cut(s) 83, 111, 200, 251, 271, 279
FaqI GGGAC 1 cut(s) 318
FatI CATG 4 cut(s) 81, 198, 269, 277
Fnu4HI GCNGC 2 cut(s) 195, 261
FokI GGATG 2 cut(s) 162, 229
Fsp4HI GCNGC 2 cut(s) 195, 261
FspBI CTAG 1 cut(s) 191
GluI GCNGC 2 cut(s) 195, 261
Hin1II CATG 4 cut(s) 85, 202, 273, 281
HinfI GANTC 1 cut(s) 220
HphI GGTGA 2 cut(s) 49, 190
Hpy166II GTNNAC 2 cut(s) 181, 314
Hpy188III TCNNGA 2 cut(s) 214, 278
Hpy8I GTNNAC 2 cut(s) 181, 314
HpyAV CCTTC 2 cut(s) 169, 294
HpyCH4III ACNGT 1 cut(s) 311
HpyCH4V TGCA 2 cut(s) 166, 273
HpyF10VI GCNNNNNNNGC 1 cut(s) 260
Hsp92II CATG 4 cut(s) 85, 202, 273, 281
LpnPI CCDG 1 cut(s) 26
Lsp1109I GCAGC 2 cut(s) 206, 272
MaeI CTAG 1 cut(s) 191
MaeIII GTNAC 1 cut(s) 228
MboII GAAGA 4 cut(s) 64, 112, 152, 332
MluCI AATT 1 cut(s) 61
MnlI CCTC 2 cut(s) 114, 316
MslI CAYNNNNRTG 1 cut(s) 80
MwoI GCNNNNNNNGC 1 cut(s) 260
NlaIII CATG 4 cut(s) 85, 202, 273, 281
PagI TCATGA 1 cut(s) 277
PfeI GAWTC 1 cut(s) 220
PkrI GCNGC 2 cut(s) 196, 262
PspPI GGNCC 1 cut(s) 153
RsaI GTAC 1 cut(s) 30
RsaNI GTAC 1 cut(s) 29
RseI CAYNNNNRTG 1 cut(s) 80
SatI GCNGC 2 cut(s) 195, 261
Sau96I GGNCC 1 cut(s) 153
SetI ASST 2 cut(s) 117, 180
SinI GGWCC 1 cut(s) 153
SmiMI CAYNNNNRTG 1 cut(s) 80
Sse9I AATT 1 cut(s) 61
SspI AATATT 1 cut(s) 133
SspMI CTAG 1 cut(s) 191
TaaI ACNGT 1 cut(s) 311
TasI AATT 1 cut(s) 61
TfiI GAWTC 1 cut(s) 220
TscAI CASTG 1 cut(s) 20
TseI GCWGC 2 cut(s) 194, 260
TspDTI ATGAA 1 cut(s) 215
TspRI CASTG 1 cut(s) 20
VpaK11BI GGWCC 1 cut(s) 153
XspI CTAG 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.