RchiOBHm_Chr5g0002811

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
1649239 .. 1651300
2062 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ28415

Sequence Viewer

Length: 123 bp
ATGTACGTCTGCGGCGTCACGCCCTACGCTGAGAGCCACGCCGCCGTCAATTTTGATGTGCTCTTTAGTATATACTTAAAAATGCCGATGCAGAGGTCGCTAATGTCTGGAAACTGCAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

40

Amino Acids

4.53

Weight (kDa)

7.81

Isoelectric Point (pI)

55.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 12, 42
AcyI GRCGYC 1 cut(s) 15
AfaI GTAC 1 cut(s) 5
Alw21I GWGCWC 1 cut(s) 63
Bbv12I GWGCWC 1 cut(s) 63
BceAI ACGGC 1 cut(s) 29
BfmI CTRYAG 1 cut(s) 115
BisI GCNGC 2 cut(s) 13, 42
BlsI GCNGC 2 cut(s) 14, 43
BmsI GCATC 1 cut(s) 78
BsaHI GRCGYC 1 cut(s) 15
BseMII CTCAG 1 cut(s) 21
BsiHKAI GWGCWC 1 cut(s) 63
Bsp1286I GDGCHC 1 cut(s) 63
BspACI CCGC 2 cut(s) 12, 42
BspCNI CTCAG 1 cut(s) 22
BspMAI CTGCAG 1 cut(s) 119
BssNI GRCGYC 1 cut(s) 15
BstACI GRCGYC 1 cut(s) 15
BstDEI CTNAG 1 cut(s) 30
BstMWI GCNNNNNNNGC 1 cut(s) 97
BstSFI CTRYAG 1 cut(s) 115
CseI GACGC 1 cut(s) 4
Csp6I GTAC 1 cut(s) 4
CviJI RGCY 1 cut(s) 36
CviKI_1 RGCY 1 cut(s) 36
CviQI GTAC 1 cut(s) 4
DdeI CTNAG 1 cut(s) 30
FaiI YATR 2 cut(s) 71, 73
Fnu4HI GCNGC 2 cut(s) 13, 42
Fsp4HI GCNGC 2 cut(s) 13, 42
FspEI CC 8 cut(s) 36, 37, 50, 55, 58, 79, 93, 99
GluI GCNGC 2 cut(s) 13, 42
HgaI GACGC 1 cut(s) 4
Hin1I GRCGYC 1 cut(s) 15
Hpy188III TCNNGA 1 cut(s) 108
HpyCH4IV ACGT 1 cut(s) 6
HpyCH4V TGCA 2 cut(s) 91, 117
HpyF10VI GCNNNNNNNGC 1 cut(s) 97
HpyF3I CTNAG 1 cut(s) 30
HpySE526I ACGT 1 cut(s) 6
Hsp92I GRCGYC 1 cut(s) 15
LpnPI CCDG 1 cut(s) 93
LweI GCATC 1 cut(s) 78
MaeII ACGT 1 cut(s) 6
MaeIII GTNAC 1 cut(s) 16
MhlI GDGCHC 1 cut(s) 63
MluCI AATT 1 cut(s) 49
MnlI CCTC 1 cut(s) 87
MseI TTAA 1 cut(s) 77
MwoI GCNNNNNNNGC 1 cut(s) 97
NmuCI GTSAC 1 cut(s) 16
PcsI WCGNNNNNNNCGW 1 cut(s) 12
PkrI GCNGC 2 cut(s) 14, 43
PstI CTGCAG 1 cut(s) 119
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 77
SatI GCNGC 2 cut(s) 13, 42
SduI GDGCHC 1 cut(s) 63
SetI ASST 2 cut(s) 9, 98
SfaNI GCATC 1 cut(s) 78
SfcI CTRYAG 1 cut(s) 115
SgeI CNNG 2 cut(s) 31, 50
Sse9I AATT 1 cut(s) 49
SsiI CCGC 2 cut(s) 12, 42
TaiI ACGT 1 cut(s) 9
TasI AATT 1 cut(s) 49
TauI GCSGC 2 cut(s) 15, 44
Tru1I TTAA 1 cut(s) 77
Tru9I TTAA 1 cut(s) 77
TseFI GTSAC 1 cut(s) 16
Tsp45I GTSAC 1 cut(s) 16
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.