Rh5CG025100

cysteine--tRNA ligase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
1570556 .. 1572000
1445 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG025100.1

Sequence Viewer

Length: 372 bp
ATGAATGCTCGTTATCTTACATACAAGTTTGATATTCATGGTGGTGGTATTGACTTGATTTTTCCGCATCATGAAAACGAGATCGCTCAAAGTGGTGCTGCATGCCAGGAGGCTTGTGTCAGTTATTGGTTGCACAACGATCATGTTACTAAGGATAATGAGAAAATGTCAAAATCATTTGGGAACTTTTCCACAATTCGTCAGACTTTGCAAGAGTGTGAAGATGCTTTATCTCCATTTCAAGAAGAGGTCCAGAAGGAAGGCACAGAACCAAACAGTTTTGTGCCTGATCTTAAGAAGAAGCAGCAGAAGCAAAAACAATCATCCGTAATCCAGGCCCTAGTTGAAAGTTGGAACAACGAGAGAAGTTAG

Protein Analysis

123

Amino Acids

14.09

Weight (kDa)

5.48

Isoelectric Point (pI)

72.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
tRNA-synt_1e PF01406 1 - 74 2.5e-29 tRNA synthetases class I (C) catalytic domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 65
AflII CTTAAG 1 cut(s) 293
AgsI TTSAA 2 cut(s) 242, 347
AjnI CCWGG 2 cut(s) 105, 333
AoxI GGCC 1 cut(s) 336
ApeKI GCWGC 2 cut(s) 98, 304
AspS9I GGNCC 2 cut(s) 250, 337
AvaII GGWCC 1 cut(s) 250
BbvI GCAGC 2 cut(s) 85, 316
BciT130I CCWGG 2 cut(s) 107, 335
BfaI CTAG 1 cut(s) 341
BfrI CTTAAG 1 cut(s) 293
BisI GCNGC 2 cut(s) 99, 305
BlsI GCNGC 2 cut(s) 100, 306
Bme1390I CCNGG 2 cut(s) 107, 335
Bme18I GGWCC 1 cut(s) 250
BmgT120I GGNCC 2 cut(s) 250, 337
BmrFI CCNGG 2 cut(s) 107, 335
BmsI GCATC 2 cut(s) 76, 214
BseBI CCWGG 2 cut(s) 107, 335
BseGI GGATG 1 cut(s) 323
BseXI GCAGC 2 cut(s) 85, 316
BshFI GGCC 1 cut(s) 338
BsmI GAATGC 1 cut(s) 10
BsnI GGCC 1 cut(s) 338
Bsp143I GATC 3 cut(s) 81, 139, 289
BspACI CCGC 1 cut(s) 65
BspANI GGCC 1 cut(s) 338
BspHI TCATGA 1 cut(s) 70
BspTI CTTAAG 1 cut(s) 293
BssMI GATC 3 cut(s) 81, 139, 289
Bst2UI CCWGG 2 cut(s) 107, 335
Bst4CI ACNGT 1 cut(s) 278
Bst6I CTCTTC 1 cut(s) 240
BstAFI CTTAAG 1 cut(s) 293
BstC8I GCNNGC 1 cut(s) 103
BstDEI CTNAG 1 cut(s) 150
BstF5I GGATG 1 cut(s) 323
BstKTI GATC 3 cut(s) 84, 142, 292
BstMBI GATC 3 cut(s) 81, 139, 289
BstMWI GCNNNNNNNGC 1 cut(s) 310
BstNI CCWGG 2 cut(s) 107, 335
BstNSI RCATGY 1 cut(s) 105
BstSCI CCNGG 2 cut(s) 105, 333
BstV1I GCAGC 2 cut(s) 85, 316
BsuRI GGCC 1 cut(s) 338
BtsCI GGATG 1 cut(s) 323
Cac8I GCNNGC 1 cut(s) 103
CciI TCATGA 1 cut(s) 70
Cfr13I GGNCC 2 cut(s) 250, 337
CviAII CATG 4 cut(s) 38, 71, 102, 143
CviJI RGCY 2 cut(s) 113, 338
CviKI_1 RGCY 2 cut(s) 113, 338
DdeI CTNAG 1 cut(s) 150
DpnI GATC 3 cut(s) 83, 141, 291
DpnII GATC 3 cut(s) 81, 139, 289
Eam1104I CTCTTC 1 cut(s) 240
EarI CTCTTC 1 cut(s) 240
Eco47I GGWCC 1 cut(s) 250
EcoO109I RGGNCCY 1 cut(s) 337
EcoRII CCWGG 2 cut(s) 105, 333
FaeI CATG 4 cut(s) 41, 74, 105, 146
FaiI YATR 5 cut(s) 22, 39, 72, 103, 144
FatI CATG 4 cut(s) 37, 70, 101, 142
Fnu4HI GCNGC 2 cut(s) 99, 305
FokI GGATG 1 cut(s) 310
Fsp4HI GCNGC 2 cut(s) 99, 305
FspBI CTAG 1 cut(s) 341
GluI GCNGC 2 cut(s) 99, 305
HaeIII GGCC 1 cut(s) 338
Hin1II CATG 4 cut(s) 41, 74, 105, 146
Hpy188I TCNGA 1 cut(s) 204
Hpy188III TCNNGA 3 cut(s) 71, 242, 253
HpyAV CCTTC 2 cut(s) 250, 254
HpyCH4III ACNGT 1 cut(s) 278
HpyCH4V TGCA 3 cut(s) 101, 133, 211
HpyF10VI GCNNNNNNNGC 1 cut(s) 310
HpyF3I CTNAG 1 cut(s) 150
Hsp92II CATG 4 cut(s) 41, 74, 105, 146
Kzo9I GATC 3 cut(s) 81, 139, 289
LpnPI CCDG 6 cut(s) 92, 119, 266, 300, 320, 347
Lsp1109I GCAGC 2 cut(s) 85, 316
LweI GCATC 2 cut(s) 76, 214
MaeI CTAG 1 cut(s) 341
MaeIII GTNAC 1 cut(s) 145
MalI GATC 3 cut(s) 83, 141, 291
MboI GATC 3 cut(s) 81, 139, 289
MboII GAAGA 3 cut(s) 233, 257, 310
MluCI AATT 1 cut(s) 195
MmeI TCCRAC 1 cut(s) 332
MnlI CCTC 2 cut(s) 103, 241
MseI TTAA 1 cut(s) 294
MslI CAYNNNNRTG 1 cut(s) 42
MspCI CTTAAG 1 cut(s) 293
MspR9I CCNGG 2 cut(s) 107, 335
Mva1269I GAATGC 1 cut(s) 10
MvaI CCWGG 2 cut(s) 107, 335
MwoI GCNNNNNNNGC 1 cut(s) 310
NdeII GATC 3 cut(s) 81, 139, 289
NlaIII CATG 4 cut(s) 41, 74, 105, 146
NspI RCATGY 1 cut(s) 105
PaeI GCATGC 1 cut(s) 105
PagI TCATGA 1 cut(s) 70
PctI GAATGC 1 cut(s) 10
PkrI GCNGC 2 cut(s) 100, 306
Psp6I CCWGG 2 cut(s) 105, 333
PspGI CCWGG 2 cut(s) 105, 333
PspPI GGNCC 2 cut(s) 250, 337
RseI CAYNNNNRTG 1 cut(s) 42
SaqAI TTAA 1 cut(s) 294
SatI GCNGC 2 cut(s) 99, 305
Sau3AI GATC 3 cut(s) 81, 139, 289
Sau96I GGNCC 2 cut(s) 250, 337
ScrFI CCNGG 2 cut(s) 107, 335
SetI ASST 1 cut(s) 252
SfaNI GCATC 2 cut(s) 76, 214
SinI GGWCC 1 cut(s) 250
SmiMI CAYNNNNRTG 1 cut(s) 42
SmlI CTYRAG 1 cut(s) 293
SmoI CTYRAG 1 cut(s) 293
SphI GCATGC 1 cut(s) 105
Sse9I AATT 1 cut(s) 195
SsiI CCGC 1 cut(s) 65
SspMI CTAG 1 cut(s) 341
StyD4I CCNGG 2 cut(s) 105, 333
TaaI ACNGT 1 cut(s) 278
TasI AATT 1 cut(s) 195
Tru1I TTAA 1 cut(s) 294
Tru9I TTAA 1 cut(s) 294
TseI GCWGC 2 cut(s) 98, 304
TspDTI ATGAA 3 cut(s) 17, 26, 87
TspGWI ACGGA 1 cut(s) 316
Vha464I CTTAAG 1 cut(s) 293
VpaK11BI GGWCC 1 cut(s) 250
XceI RCATGY 1 cut(s) 105
XspI CTAG 1 cut(s) 341
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.