Rh1DG061300

cysteine--tRNA ligase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
10765724 .. 10766046
323 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG061300.1

Sequence Viewer

Length: 243 bp
ATGATCATCGACAATGACTATGCCTACGTAGTTGATGGGGATGTATTCTCTGCTGTTGCGGAATTCCCAAATTATGGACAATTATCTAGACAGAAGTTGGAACATATTAGGGCGGGTGAACGAGTTTCTGTTGATTCAAGAAAGCGCAATCCTGCAGATTTTGCATTGTGGAAGTCCTGCAAAGCCTGGAGAGCCAAAATGGGACAGCGACTGGGGACCAGGAAGGCCGGGGTGGCACATTGA

Protein Analysis

80

Amino Acids

9.05

Weight (kDa)

9.72

Isoelectric Point (pI)

37.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
tRNA-synt_1e PF01406 2 - 66 1e-14 tRNA synthetases class I (C) catalytic domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 74
AciI CCGC 2 cut(s) 59, 113
AcsI RAATTY 1 cut(s) 62
AfiI CCNNNNNNNGG 1 cut(s) 74
AgsI TTSAA 1 cut(s) 138
AjnI CCWGG 2 cut(s) 185, 218
AlwNI CAGNNNCTG 1 cut(s) 211
AoxI GGCC 1 cut(s) 225
ApoI RAATTY 1 cut(s) 62
AspLEI GCGC 1 cut(s) 147
AspS9I GGNCC 1 cut(s) 216
AsuC2I CCSGG 1 cut(s) 229
AsuHPI GGTGA 1 cut(s) 128
AvaII GGWCC 1 cut(s) 216
BccI CCATC 1 cut(s) 29
BciT130I CCWGG 2 cut(s) 187, 220
BclI TGATCA 1 cut(s) 3
BcnI CCSGG 1 cut(s) 229
BfaI CTAG 1 cut(s) 87
BfmI CTRYAG 1 cut(s) 153
BglI GCCNNNNNGGC 1 cut(s) 233
Bme1390I CCNGG 3 cut(s) 187, 220, 229
Bme18I GGWCC 1 cut(s) 216
BmgT120I GGNCC 1 cut(s) 216
BmiI GGNNCC 1 cut(s) 217
BmrFI CCNGG 3 cut(s) 187, 220, 229
BmrI ACTGGG 1 cut(s) 221
BmuI ACTGGG 1 cut(s) 221
BpmI CTGGAG 1 cut(s) 208
BpuMI CCSGG 1 cut(s) 229
BsaAI YACGTR 1 cut(s) 28
BsaJI CCNNGG 1 cut(s) 228
Bsc4I CCNNNNNNNGG 1 cut(s) 74
Bse1I ACTGG 1 cut(s) 216
BseBI CCWGG 2 cut(s) 187, 220
BseDI CCNNGG 1 cut(s) 228
BseGI GGATG 1 cut(s) 46
BseLI CCNNNNNNNGG 1 cut(s) 74
BseNI ACTGG 1 cut(s) 216
BshFI GGCC 1 cut(s) 227
BsiSI CCGG 1 cut(s) 228
BslFI GGGAC 2 cut(s) 216, 229
BslI CCNNNNNNNGG 1 cut(s) 74
BsmFI GGGAC 2 cut(s) 216, 229
BsnI GGCC 1 cut(s) 227
Bsp143I GATC 1 cut(s) 3
BspACI CCGC 2 cut(s) 59, 113
BspANI GGCC 1 cut(s) 227
BspLI GGNNCC 1 cut(s) 217
BspMAI CTGCAG 1 cut(s) 157
BsrI ACTGG 1 cut(s) 216
BssECI CCNNGG 1 cut(s) 228
BssMI GATC 1 cut(s) 3
Bst2UI CCWGG 2 cut(s) 187, 220
BstAPI GCANNNNNTGC 1 cut(s) 161
BstBAI YACGTR 1 cut(s) 28
BstF5I GGATG 1 cut(s) 46
BstHHI GCGC 1 cut(s) 147
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstMWI GCNNNNNNNGC 3 cut(s) 161, 191, 233
BstNI CCWGG 2 cut(s) 187, 220
BstSCI CCNGG 3 cut(s) 185, 218, 227
BstSFI CTRYAG 1 cut(s) 153
BstSNI TACGTA 1 cut(s) 28
BsuRI GGCC 1 cut(s) 227
BtsCI GGATG 1 cut(s) 46
CaiI CAGNNNCTG 1 cut(s) 211
CfoI GCGC 1 cut(s) 147
Cfr13I GGNCC 1 cut(s) 216
CviJI RGCY 3 cut(s) 185, 194, 227
CviKI_1 RGCY 3 cut(s) 185, 194, 227
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eco105I TACGTA 1 cut(s) 28
Eco47I GGWCC 1 cut(s) 216
EcoRI GAATTC 1 cut(s) 62
EcoRII CCWGG 2 cut(s) 185, 218
FaiI YATR 3 cut(s) 21, 75, 105
FaqI GGGAC 2 cut(s) 216, 229
FauI CCCGC 1 cut(s) 106
FbaI TGATCA 1 cut(s) 3
FokI GGATG 1 cut(s) 53
FspBI CTAG 1 cut(s) 87
GlaI GCGC 1 cut(s) 146
GsuI CTGGAG 1 cut(s) 208
HaeIII GGCC 1 cut(s) 227
HapII CCGG 1 cut(s) 228
HhaI GCGC 1 cut(s) 147
Hin6I GCGC 1 cut(s) 145
HinP1I GCGC 1 cut(s) 145
HinfI GANTC 1 cut(s) 134
HpaII CCGG 1 cut(s) 228
HphI GGTGA 1 cut(s) 128
Hpy166II GTNNAC 1 cut(s) 119
Hpy188III TCNNGA 2 cut(s) 87, 138
Hpy8I GTNNAC 1 cut(s) 119
HpyAV CCTTC 1 cut(s) 217
HpyCH4IV ACGT 1 cut(s) 27
HpyCH4V TGCA 3 cut(s) 155, 164, 180
HpyF10VI GCNNNNNNNGC 3 cut(s) 161, 191, 233
HpySE526I ACGT 1 cut(s) 27
HspAI GCGC 1 cut(s) 145
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 7 cut(s) 165, 172, 190, 197, 199, 205, 232
MaeI CTAG 1 cut(s) 87
MaeII ACGT 1 cut(s) 27
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MluCI AATT 3 cut(s) 62, 70, 80
MmeI TCCRAC 1 cut(s) 78
MspI CCGG 1 cut(s) 228
MspR9I CCNGG 3 cut(s) 187, 220, 229
MvaI CCWGG 2 cut(s) 187, 220
MwoI GCNNNNNNNGC 3 cut(s) 161, 191, 233
NciI CCSGG 1 cut(s) 229
NdeII GATC 1 cut(s) 3
NlaIV GGNNCC 1 cut(s) 217
PfeI GAWTC 1 cut(s) 134
PflMI CCANNNNNTGG 1 cut(s) 74
Ppu21I YACGTR 1 cut(s) 28
Psp6I CCWGG 2 cut(s) 185, 218
PspGI CCWGG 2 cut(s) 185, 218
PspN4I GGNNCC 1 cut(s) 217
PspPI GGNCC 1 cut(s) 216
PstI CTGCAG 1 cut(s) 157
PstNI CAGNNNCTG 1 cut(s) 211
Sau3AI GATC 1 cut(s) 3
Sau96I GGNCC 1 cut(s) 216
ScrFI CCNGG 3 cut(s) 187, 220, 229
SetI ASST 1 cut(s) 30
SfcI CTRYAG 1 cut(s) 153
SinI GGWCC 1 cut(s) 216
SnaBI TACGTA 1 cut(s) 28
Sse9I AATT 3 cut(s) 62, 70, 80
SsiI CCGC 2 cut(s) 59, 113
SspMI CTAG 1 cut(s) 87
StyD4I CCNGG 3 cut(s) 185, 218, 227
TaiI ACGT 1 cut(s) 30
TaqI TCGA 1 cut(s) 9
TasI AATT 3 cut(s) 62, 70, 80
TfiI GAWTC 1 cut(s) 134
Van91I CCANNNNNTGG 1 cut(s) 74
VpaK11BI GGWCC 1 cut(s) 216
XapI RAATTY 1 cut(s) 62
XbaI TCTAGA 1 cut(s) 86
XspI CTAG 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.