RchiOBHm_Chr5g0054891

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0004863
Physical Location & Seq
Reverse (-)
57616358 .. 57616857
500 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33195

Sequence Viewer

Length: 360 bp
ATGGCCCCTACCATGGATTATGCAAGGAATATGTTCGATGCCATGCCTGAAAGAGAGGTATTTCTTTGGAACACCTTGATCAGGGGTAATGCTGATCGGGGAGCTTGTCATGAAGCCATAGTTTTGCACAGAAAAATCTCCTTGGTGAGTATGTATGCAAAGAATGGTGAAACTTTGAACTCAGAGCTGGTTTTTAATGCAATGGTTGTGAAGAACATAGTTTCCTGGACTGCAATGACAGCAGGCTATGTGAAAAATGGGTTCTATAAAGAAGGGTTGAGTCTTTTGCAAGACATGATTGCTTCAGGTTCCCAACCAAATGTTGGTTACACTGGTCAGCATCCACCCTACTTATGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00290 ko00650 ko00660 ko00770 ko01100 ko01110 ko01130 ko01210 ko01230 map00290 map00650 map00660 map00770 map01100 map01110 map01130 map01210 map01230
Pfam Domains
Protein Families
PPR PPR_2

Protein Analysis

119

Amino Acids

13.28

Weight (kDa)

6.82

Isoelectric Point (pI)

36.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR PF01535 74 - 103 1.4e-06 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 323
AcuI CTGAAG 1 cut(s) 288
AfiI CCNNNNNNNGG 3 cut(s) 13, 81, 323
AgsI TTSAA 1 cut(s) 178
AjnI CCWGG 1 cut(s) 224
AloI GAACNNNNNNTCC 2 cut(s) 206, 238
AluBI AGCT 2 cut(s) 104, 187
AluI AGCT 2 cut(s) 104, 187
AoxI GGCC 1 cut(s) 3
Asp700I GAANNNNTTC 1 cut(s) 32
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 2 cut(s) 157, 179
BciT130I CCWGG 1 cut(s) 226
BclI TGATCA 1 cut(s) 78
BfaI CTAG 1 cut(s) 358
Bme1390I CCNGG 1 cut(s) 226
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 2 cut(s) 6, 310
BmrFI CCNGG 1 cut(s) 226
BmsI GCATC 2 cut(s) 28, 349
BsaJI CCNNGG 2 cut(s) 12, 141
Bsc4I CCNNNNNNNGG 3 cut(s) 13, 81, 323
Bse1I ACTGG 1 cut(s) 337
Bse3DI GCAATG 2 cut(s) 207, 240
BseBI CCWGG 1 cut(s) 226
BseDI CCNNGG 2 cut(s) 12, 141
BseGI GGATG 1 cut(s) 340
BseLI CCNNNNNNNGG 3 cut(s) 13, 81, 323
BseMI GCAATG 2 cut(s) 207, 240
BseMII CTCAG 1 cut(s) 195
BseNI ACTGG 1 cut(s) 337
BshFI GGCC 1 cut(s) 5
BslI CCNNNNNNNGG 3 cut(s) 13, 81, 323
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 2 cut(s) 78, 94
Bsp19I CCATGG 1 cut(s) 12
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 194
BspHI TCATGA 1 cut(s) 109
BspLI GGNNCC 2 cut(s) 6, 310
BsrDI GCAATG 2 cut(s) 207, 240
BsrI ACTGG 1 cut(s) 337
BssECI CCNNGG 2 cut(s) 12, 141
BssMI GATC 2 cut(s) 78, 94
BssT1I CCWWGG 2 cut(s) 12, 141
Bst2UI CCWGG 1 cut(s) 226
BstC8I GCNNGC 1 cut(s) 244
BstDEI CTNAG 1 cut(s) 181
BstDSI CCRYGG 1 cut(s) 12
BstENI CCTNNNNNAGG 1 cut(s) 79
BstF5I GGATG 1 cut(s) 340
BstKTI GATC 2 cut(s) 81, 97
BstMBI GATC 2 cut(s) 78, 94
BstMWI GCNNNNNNNGC 1 cut(s) 239
BstNI CCWGG 1 cut(s) 226
BstSCI CCNGG 1 cut(s) 224
BsuRI GGCC 1 cut(s) 5
BtgI CCRYGG 1 cut(s) 12
BtsCI GGATG 1 cut(s) 340
BtsIMutI CAGTG 1 cut(s) 330
Cac8I GCNNGC 1 cut(s) 244
CciI TCATGA 1 cut(s) 109
Cfr13I GGNCC 1 cut(s) 4
CviAII CATG 4 cut(s) 13, 43, 110, 295
CviJI RGCY 5 cut(s) 5, 104, 116, 187, 246
CviKI_1 RGCY 5 cut(s) 5, 104, 116, 187, 246
DdeI CTNAG 1 cut(s) 181
DpnI GATC 2 cut(s) 80, 96
DpnII GATC 2 cut(s) 78, 94
Eco130I CCWWGG 2 cut(s) 12, 141
Eco57I CTGAAG 1 cut(s) 288
EcoNI CCTNNNNNAGG 1 cut(s) 79
EcoRII CCWGG 1 cut(s) 224
EcoT14I CCWWGG 2 cut(s) 12, 141
ErhI CCWWGG 2 cut(s) 12, 141
FaeI CATG 4 cut(s) 16, 46, 113, 298
FatI CATG 4 cut(s) 12, 42, 109, 294
FbaI TGATCA 1 cut(s) 78
FokI GGATG 1 cut(s) 327
FspBI CTAG 1 cut(s) 358
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 4 cut(s) 16, 46, 113, 298
HinfI GANTC 1 cut(s) 280
HphI GGTGA 2 cut(s) 157, 179
Hpy188I TCNGA 1 cut(s) 184
Hpy188III TCNNGA 1 cut(s) 110
HpyAV CCTTC 1 cut(s) 266
HpyCH4V TGCA 6 cut(s) 23, 127, 158, 200, 233, 289
HpyF10VI GCNNNNNNNGC 1 cut(s) 239
HpyF3I CTNAG 1 cut(s) 181
Hsp92II CATG 4 cut(s) 16, 46, 113, 298
Ksp22I TGATCA 1 cut(s) 78
Kzo9I GATC 2 cut(s) 78, 94
LmnI GCTCC 1 cut(s) 101
LpnPI CCDG 8 cut(s) 60, 67, 173, 211, 228, 238, 291, 318
LweI GCATC 2 cut(s) 28, 349
MaeI CTAG 1 cut(s) 358
MaeIII GTNAC 1 cut(s) 326
MalI GATC 2 cut(s) 80, 96
MboI GATC 2 cut(s) 78, 94
MboII GAAGA 1 cut(s) 223
MlyI GAGTC 1 cut(s) 289
MnlI CCTC 1 cut(s) 49
MroXI GAANNNNTTC 1 cut(s) 32
MseI TTAA 1 cut(s) 195
MspR9I CCNGG 1 cut(s) 226
MvaI CCWGG 1 cut(s) 226
MwoI GCNNNNNNNGC 1 cut(s) 239
NcoI CCATGG 1 cut(s) 12
NdeII GATC 2 cut(s) 78, 94
NlaIII CATG 4 cut(s) 16, 46, 113, 298
NlaIV GGNNCC 2 cut(s) 6, 310
PagI TCATGA 1 cut(s) 109
PdmI GAANNNNTTC 1 cut(s) 32
PflMI CCANNNNNTGG 1 cut(s) 323
PfoI TCCNGGA 1 cut(s) 224
PleI GAGTC 1 cut(s) 288
PpsI GAGTC 1 cut(s) 288
Psp6I CCWGG 1 cut(s) 224
PspGI CCWGG 1 cut(s) 224
PspN4I GGNNCC 2 cut(s) 6, 310
PspPI GGNCC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 195
Sau3AI GATC 2 cut(s) 78, 94
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 1 cut(s) 289
ScrFI CCNGG 1 cut(s) 226
SetI ASST 5 cut(s) 60, 77, 106, 189, 310
SfaNI GCATC 2 cut(s) 28, 349
SspMI CTAG 1 cut(s) 358
StyD4I CCNGG 1 cut(s) 224
StyI CCWWGG 2 cut(s) 12, 141
TaqI TCGA 1 cut(s) 36
Tru1I TTAA 1 cut(s) 195
Tru9I TTAA 1 cut(s) 195
TscAI CASTG 1 cut(s) 337
TspDTI ATGAA 1 cut(s) 126
TspRI CASTG 1 cut(s) 337
Van91I CCANNNNNTGG 1 cut(s) 323
XagI CCTNNNNNAGG 1 cut(s) 79
XcmI CCANNNNNNNNNTGG 1 cut(s) 320
XmnI GAANNNNTTC 1 cut(s) 32
XspI CTAG 1 cut(s) 358
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.