RchiOBHm_Chr6g0247511

OTU domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
3448318 .. 3449439
1122 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22187

Sequence Viewer

Length: 507 bp
ATGTCTGCTGTGAATGATGCACAATTTGGAACAATGATTATTGCTGCTATCGACAAGGCTGGACAAAATGCTAAGAAAAAGCAAGTGGAGGAAGAGATTTCTCAACTTTCTACTGAGCTTAAAGAAAAACAAGCTAAAGAACATGCATTATTAAGCTATAGCAGCACTGACAATGGAGGTGAATTGAGTAATCTGGATACTTTAGTGAAGGTCATAGCTGGTGTTTCTGTATGCAGTCAACTTGAGAATGTAAAGCCTAGCAAGAGTTTAAAGAAAAAAGTGAAAAGGGCTCAGGATGATGCAAGAAGGAAGCAGAGAATTCAAGAAGAGCAGAGCAAGTCAATAAGCAATCAAATGGTTGAGAATGAGAAACTAGGAAAAAAGCTTGAGCCCCTTGGCTTGACAATTAATAAGATAATTCCTGATGGTCATTGCCTCTACCGTGCTATCCAGGATCAGTTAGCCCACCTTTCTGGAGGCTCTTCACCTTACTCATACCAAGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

168

Amino Acids

18.48

Weight (kDa)

8.97

Isoelectric Point (pI)

38.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 462
AcsI RAATTY 1 cut(s) 318
AgsI TTSAA 1 cut(s) 323
AjnI CCWGG 1 cut(s) 450
AluBI AGCT 5 cut(s) 118, 134, 156, 218, 385
AluI AGCT 5 cut(s) 118, 134, 156, 218, 385
AlwI GGATC 1 cut(s) 462
ApeKI GCWGC 2 cut(s) 44, 162
ApoI RAATTY 1 cut(s) 318
AseI ATTAAT 1 cut(s) 408
AsuHPI GGTGA 2 cut(s) 191, 477
BaeI ACNNNNGTAYC 2 cut(s) 189, 222
BanII GRGCYC 2 cut(s) 292, 393
BbvI GCAGC 2 cut(s) 31, 174
BccI CCATC 1 cut(s) 419
BciT130I CCWGG 1 cut(s) 452
BciVI GTATCC 1 cut(s) 190
BfaI CTAG 2 cut(s) 258, 374
BfmI CTRYAG 1 cut(s) 157
BfuI GTATCC 1 cut(s) 190
BisI GCNGC 2 cut(s) 45, 163
BlsI GCNGC 2 cut(s) 46, 164
Bme1390I CCNGG 1 cut(s) 452
BmrFI CCNGG 1 cut(s) 452
BmsI GCATC 2 cut(s) 7, 289
BpmI CTGGAG 1 cut(s) 495
Bpu10I CCTNAGC 1 cut(s) 291
BpuEI CTTGAG 2 cut(s) 263, 407
BsaJI CCNNGG 1 cut(s) 394
Bse3DI GCAATG 1 cut(s) 430
BseBI CCWGG 1 cut(s) 452
BseDI CCNNGG 1 cut(s) 394
BseGI GGATG 1 cut(s) 301
BseMI GCAATG 1 cut(s) 430
BseMII CTCAG 2 cut(s) 105, 305
BseXI GCAGC 2 cut(s) 31, 174
Bsp1286I GDGCHC 2 cut(s) 292, 393
Bsp143I GATC 1 cut(s) 454
BspCNI CTCAG 2 cut(s) 106, 304
BspPI GGATC 1 cut(s) 462
BspQI GCTCTTC 2 cut(s) 321, 487
BsrDI GCAATG 1 cut(s) 430
BssECI CCNNGG 1 cut(s) 394
BssMI GATC 1 cut(s) 454
BssT1I CCWWGG 1 cut(s) 394
Bst2UI CCWGG 1 cut(s) 452
Bst4CI ACNGT 1 cut(s) 443
Bst6I CTCTTC 3 cut(s) 87, 321, 487
BstDEI CTNAG 3 cut(s) 72, 114, 291
BstF5I GGATG 1 cut(s) 301
BstKTI GATC 1 cut(s) 457
BstMBI GATC 1 cut(s) 454
BstMWI GCNNNNNNNGC 1 cut(s) 162
BstNI CCWGG 1 cut(s) 452
BstNSI RCATGY 1 cut(s) 146
BstSCI CCNGG 1 cut(s) 450
BstSFI CTRYAG 1 cut(s) 157
BstV1I GCAGC 2 cut(s) 31, 174
BstXI CCANNNNNNTGG 1 cut(s) 473
BsuI GTATCC 1 cut(s) 190
BtsCI GGATG 1 cut(s) 301
BtsIMutI CAGTG 1 cut(s) 165
CviAII CATG 1 cut(s) 143
DdeI CTNAG 3 cut(s) 72, 114, 291
DpnI GATC 1 cut(s) 456
DpnII GATC 1 cut(s) 454
DraI TTTAAA 1 cut(s) 270
Eam1104I CTCTTC 3 cut(s) 87, 321, 487
EarI CTCTTC 3 cut(s) 87, 321, 487
Eco130I CCWWGG 1 cut(s) 394
Eco24I GRGCYC 2 cut(s) 292, 393
EcoRI GAATTC 1 cut(s) 318
EcoRII CCWGG 1 cut(s) 450
EcoT14I CCWWGG 1 cut(s) 394
EcoT22I ATGCAT 1 cut(s) 148
EcoT38I GRGCYC 2 cut(s) 292, 393
ErhI CCWWGG 1 cut(s) 394
FaeI CATG 1 cut(s) 146
FaiI YATR 6 cut(s) 144, 159, 215, 232, 496, 505
FatI CATG 1 cut(s) 142
Fnu4HI GCNGC 2 cut(s) 45, 163
FokI GGATG 1 cut(s) 308
FriOI GRGCYC 2 cut(s) 292, 393
Fsp4HI GCNGC 2 cut(s) 45, 163
FspBI CTAG 2 cut(s) 258, 374
GluI GCNGC 2 cut(s) 45, 163
GsuI CTGGAG 1 cut(s) 495
Hin1II CATG 1 cut(s) 146
HincII GTYRAC 1 cut(s) 239
HindII GTYRAC 1 cut(s) 239
HindIII AAGCTT 1 cut(s) 383
HphI GGTGA 2 cut(s) 191, 477
Hpy166II GTNNAC 1 cut(s) 239
Hpy188III TCNNGA 5 cut(s) 194, 293, 323, 422, 474
Hpy8I GTNNAC 1 cut(s) 239
HpyAV CCTTC 2 cut(s) 202, 300
HpyCH4III ACNGT 1 cut(s) 443
HpyCH4V TGCA 4 cut(s) 20, 146, 234, 302
HpyF10VI GCNNNNNNNGC 1 cut(s) 162
HpyF3I CTNAG 3 cut(s) 72, 114, 291
Hsp92II CATG 1 cut(s) 146
Kzo9I GATC 1 cut(s) 454
LguI GCTCTTC 2 cut(s) 321, 487
LpnPI CCDG 8 cut(s) 45, 179, 204, 278, 435, 437, 459, 464
Lsp1109I GCAGC 2 cut(s) 31, 174
LweI GCATC 2 cut(s) 7, 289
MaeI CTAG 2 cut(s) 258, 374
MalI GATC 1 cut(s) 456
MboI GATC 1 cut(s) 454
MboII GAAGA 3 cut(s) 104, 338, 474
MhlI GDGCHC 2 cut(s) 292, 393
MluCI AATT 5 cut(s) 23, 182, 318, 405, 417
MnlI CCTC 4 cut(s) 82, 170, 446, 470
Mph1103I ATGCAT 1 cut(s) 148
MseI TTAA 4 cut(s) 120, 152, 269, 408
MspR9I CCNGG 1 cut(s) 452
MvaI CCWGG 1 cut(s) 452
MwoI GCNNNNNNNGC 1 cut(s) 162
NdeII GATC 1 cut(s) 454
NlaIII CATG 1 cut(s) 146
NsiI ATGCAT 1 cut(s) 148
NspI RCATGY 1 cut(s) 146
PciSI GCTCTTC 2 cut(s) 321, 487
PfoI TCCNGGA 1 cut(s) 450
PkrI GCNGC 2 cut(s) 46, 164
PshBI ATTAAT 1 cut(s) 408
Psp6I CCWGG 1 cut(s) 450
PspGI CCWGG 1 cut(s) 450
SapI GCTCTTC 2 cut(s) 321, 487
SaqAI TTAA 4 cut(s) 120, 152, 269, 408
SatI GCNGC 2 cut(s) 45, 163
Sau3AI GATC 1 cut(s) 454
ScrFI CCNGG 1 cut(s) 452
SduI GDGCHC 2 cut(s) 292, 393
SetI ASST 9 cut(s) 120, 136, 158, 181, 213, 220, 387, 471, 490
SfaNI GCATC 2 cut(s) 7, 289
SfcI CTRYAG 1 cut(s) 157
SmlI CTYRAG 2 cut(s) 242, 386
SmoI CTYRAG 2 cut(s) 242, 386
Sse9I AATT 5 cut(s) 23, 182, 318, 405, 417
SspMI CTAG 2 cut(s) 258, 374
StyD4I CCNGG 1 cut(s) 450
StyI CCWWGG 1 cut(s) 394
TaaI ACNGT 1 cut(s) 443
TaqI TCGA 1 cut(s) 51
TasI AATT 5 cut(s) 23, 182, 318, 405, 417
Tru1I TTAA 4 cut(s) 120, 152, 269, 408
Tru9I TTAA 4 cut(s) 120, 152, 269, 408
TscAI CASTG 1 cut(s) 172
TseI GCWGC 2 cut(s) 44, 162
TspRI CASTG 1 cut(s) 172
VspI ATTAAT 1 cut(s) 408
XapI RAATTY 1 cut(s) 318
XceI RCATGY 1 cut(s) 146
XspI CTAG 2 cut(s) 258, 374
Zsp2I ATGCAT 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.