Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000147.1

Orthogroup ID

OG0002523

Physical Location & Seq

Genomic Coordinates Forward (+)

351397 .. 352425

Gene Structure 1029 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000147.1_g000079.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1029 bp

atggggtcgaggagggctggagatccaccacaatattcgtcaacaccgctgtgtccacctgacccaaataaattgaggatgaagctccaaatcgagatagaagagacagctgcgagatgtcatgaactttggaaatctatggcatcaatggcggcagaaccggttgtatttcagtccgagatattacacgagttgaggcaatttcggttggagcaaacagctcagttgaggccgccgcctccaccaccacctccggcaacgacggattcctaccactaccagcaccaacaagcaccacagtattcaccgactctactgcggaaactgcctccatttcctgttccgaacccccaacacacattgctacggctccaaaccttcgcttcagagctgcaacaacggttaaatcagtttttcttagtaagtgatactagcactagagtttctaatcagttcaattttctgaatgatgattgcaatggtgtgggttcagtggtgtttggtgctaaattaaaaggtattgatgagaagttaaatactgtgggggcagattggtctaataagacggttgaggtgattagtggggatattagagagtttaatgagcttaagagtgtgacctctggtgaaaatcctgtctcaataaagaaggggattgataaactgcacagacaggatcaactagaaaacaaatctaggcttgctatgaatgatgcacaatttggaacaatgattattgctgctatcgacaaggctggacaaaatgctaagaaaaagcaagtggaggaagagatttctcaactttctactgagcttaaagaaaaaaaagctaaagaacatgcatcattgagctatagcagcactgacaatggaggtgaattgagtaatctggatactttagtgaaggtcatagctggtgttactgtatgcagtcaacttgagaatgtaaagcctagcaagattttaaagaaaaaagtaaaaagggctcaggaggatgcaagaaggaagcagagaattcaagaagagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

OTU

Protein Analysis

342

Amino Acids

38.36

Weight (kDa)

8.86

Isoelectric Point (pI)

52.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002523)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G62940 AT3G62940 AT3G62940 AT3G62940 AT3G62940
fragaria_vesca	FvH4_2g14201 FvH4_2g14201 FvH4_2g14201
malus_domestica	MD03G1278200.v1.1 MD11G1300200.v1.1
prunus_persica	Prupe.2G090200_v2.0.a1 Prupe.2G090200_v2.0.a1 Prupe.8G254400_v2.0.a1 Prupe.8G254400_v2.0.a1 Prupe.8G254400_v2.0.a1
pyrus_communis	pycom03g22160 pycom11g26360
rosa_chinensis	RchiOBHm_Chr3g0496291 RchiOBHm_Chr5g0001231 RchiOBHm_Chr5g0082561 RchiOBHm_Chr6g0247511 RchiOBHm_Chr6g0292881
rosa_laevigata	RLG00000011983 RLG00000015114 RLG00000015120
rosa_multiflora	Rmu_sc0000147.1_g000079 Rmu_sc0000391.1_g000019 Rmu_sc0000391.1_g000020 Rmu_sc0000639.1_g000016 Rmu_ssc0000454.1_g000017
rosa_roxburghii	Rroxscaffold_4G00287890 Rroxscaffold_6G00416780 Rroxscaffold_7G00174620 Rroxscaffold_7G00186560
rosa_rugosa	Rorug06G0230500
rosa_samantha	Rh3CG361400 Rh6AG343800 Rh6BG351000 Rh6CG358000 Rh6DG343900
rosa_wichuraiana	Rw6G029990

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	5 cut(s)	47, 152, 233, 236, 319
AclWI	GGATC	2 cut(s)	17, 684
AcsI	RAATTY	1 cut(s)	1014
AcuI	CTGAAG	1 cut(s)	369
AflII	CTTAAG	1 cut(s)	608
AgeI	ACCGGT	1 cut(s)	160
AgsI	TTSAA	2 cut(s)	457, 1019
AleI	CACNNNNGTG	1 cut(s)	49
AluBI	AGCT	9 cut(s)	85, 110, 221, 391, 607, 814, 830, 852, 914
AluI	AGCT	9 cut(s)	85, 110, 221, 391, 607, 814, 830, 852, 914
Alw26I	GTCTC	2 cut(s)	98, 643
AlwI	GGATC	2 cut(s)	17, 684
AoxI	GGCC	1 cut(s)	230
ApeKI	GCWGC	4 cut(s)	110, 391, 740, 858
ApoI	RAATTY	1 cut(s)	1014
AsiGI	ACCGGT	1 cut(s)	160
AsuHPI	GGTGA	4 cut(s)	297, 586, 638, 887
BaeI	ACNNNNGTAYC	2 cut(s)	885, 918
BanII	GRGCYC	1 cut(s)	988
BauI	CACGAG	1 cut(s)	188
BbvI	GCAGC	4 cut(s)	97, 378, 727, 870
BceAI	ACGGC	1 cut(s)	383
BcgI	CGANNNNNNTGC	2 cut(s)	298, 332
BciVI	GTATCC	1 cut(s)	886
BcoDI	GTCTC	2 cut(s)	98, 643
BfaI	CTAG	5 cut(s)	432, 438, 683, 696, 954
BfmI	CTRYAG	1 cut(s)	853
BfrI	CTTAAG	1 cut(s)	608
BfuI	GTATCC	1 cut(s)	886
BisI	GCNGC	7 cut(s)	111, 153, 233, 236, 392, 741, 859
BlsI	GCNGC	7 cut(s)	112, 154, 234, 237, 393, 742, 860
BmiI	GGNNCC	1 cut(s)	371
BmsI	GCATC	4 cut(s)	152, 703, 851, 985
BpmI	CTGGAG	1 cut(s)	39
Bpu10I	CCTNAGC	1 cut(s)	987
BpuEI	CTTGAG	1 cut(s)	959
BsaWI	WCCGGW	1 cut(s)	160
Bse118I	RCCGGY	1 cut(s)	160
Bse3DI	GCAATG	2 cut(s)	359, 484
BseGI	GGATG	2 cut(s)	84, 1000
BseMI	GCAATG	2 cut(s)	359, 484
BseMII	CTCAG	3 cut(s)	236, 801, 1001
BseRI	GAGGAG	1 cut(s)	25
BseXI	GCAGC	4 cut(s)	97, 378, 727, 870
BsgI	GTGCAG	1 cut(s)	650
BshFI	GGCC	1 cut(s)	232
BshTI	ACCGGT	1 cut(s)	160
BsiSI	CCGG	2 cut(s)	161, 254
BsmAI	GTCTC	2 cut(s)	98, 643
BsnI	GGCC	1 cut(s)	232
Bsp1286I	GDGCHC	1 cut(s)	988
Bsp143I	GATC	2 cut(s)	22, 676
BspACI	CCGC	5 cut(s)	47, 152, 233, 236, 319
BspANI	GGCC	1 cut(s)	232
BspCNI	CTCAG	3 cut(s)	235, 802, 1000
BspHI	TCATGA	1 cut(s)	121
BspLI	GGNNCC	1 cut(s)	371
BspPI	GGATC	2 cut(s)	17, 684
BspTI	CTTAAG	1 cut(s)	608
BsrDI	GCAATG	2 cut(s)	359, 484
BsrFI	RCCGGY	1 cut(s)	160
BssAI	RCCGGY	1 cut(s)	160
BssMI	GATC	2 cut(s)	22, 676
BssSI	CACGAG	1 cut(s)	188
Bst2BI	CACGAG	1 cut(s)	188
Bst4CI	ACNGT	5 cut(s)	300, 402, 541, 568, 925
Bst6I	CTCTTC	3 cut(s)	96, 783, 1017
BstAFI	CTTAAG	1 cut(s)	608
BstC8I	GCNNGC	1 cut(s)	702
BstDEI	CTNAG	5 cut(s)	222, 418, 768, 810, 987
BstF5I	GGATG	2 cut(s)	84, 1000
BstKTI	GATC	2 cut(s)	25, 679
BstMAI	GTCTC	2 cut(s)	98, 643
BstMBI	GATC	2 cut(s)	22, 676
BstMWI	GCNNNNNNNGC	3 cut(s)	149, 325, 858
BstNSI	RCATGY	1 cut(s)	842
BstSFI	CTRYAG	1 cut(s)	853
BstV1I	GCAGC	4 cut(s)	97, 378, 727, 870
BstX2I	RGATCY	1 cut(s)	22
BstYI	RGATCY	1 cut(s)	22
BsuI	GTATCC	1 cut(s)	886
BsuRI	GGCC	1 cut(s)	232
BtsCI	GGATG	2 cut(s)	84, 1000
BtsIMutI	CAGTG	2 cut(s)	498, 861
Cac8I	GCNNGC	1 cut(s)	702
CciI	TCATGA	1 cut(s)	121
Cfr10I	RCCGGY	1 cut(s)	160
CspAI	ACCGGT	1 cut(s)	160
CviAII	CATG	2 cut(s)	122, 839
DdeI	CTNAG	5 cut(s)	222, 418, 768, 810, 987
DpnI	GATC	2 cut(s)	24, 678
DpnII	GATC	2 cut(s)	22, 676
DraI	TTTAAA	1 cut(s)	966
Eam1104I	CTCTTC	3 cut(s)	96, 783, 1017
EarI	CTCTTC	3 cut(s)	96, 783, 1017
Eco24I	GRGCYC	1 cut(s)	988
Eco57I	CTGAAG	1 cut(s)	369
EcoRI	GAATTC	1 cut(s)	1014
EcoT22I	ATGCAT	1 cut(s)	844
EcoT38I	GRGCYC	1 cut(s)	988
FaeI	CATG	2 cut(s)	125, 842
FaiI	YATR	7 cut(s)	123, 140, 707, 840, 855, 911, 928
FatI	CATG	2 cut(s)	121, 838
Fnu4HI	GCNGC	7 cut(s)	111, 153, 233, 236, 392, 741, 859
FokI	GGATG	2 cut(s)	91, 1007
FriOI	GRGCYC	1 cut(s)	988
Fsp4HI	GCNGC	7 cut(s)	111, 153, 233, 236, 392, 741, 859
FspBI	CTAG	5 cut(s)	432, 438, 683, 696, 954
GluI	GCNGC	7 cut(s)	111, 153, 233, 236, 392, 741, 859
GsuI	CTGGAG	1 cut(s)	39
HaeIII	GGCC	1 cut(s)	232
HapII	CCGG	2 cut(s)	161, 254
Hin1II	CATG	2 cut(s)	125, 842
HincII	GTYRAC	2 cut(s)	42, 935
HindII	GTYRAC	2 cut(s)	42, 935
HinfI	GANTC	2 cut(s)	266, 310
HpaII	CCGG	2 cut(s)	161, 254
HphI	GGTGA	4 cut(s)	297, 586, 638, 887
Hpy166II	GTNNAC	3 cut(s)	42, 56, 935
Hpy188I	TCNGA	4 cut(s)	178, 345, 388, 465
Hpy188III	TCNNGA	5 cut(s)	94, 122, 890, 989, 1019
Hpy8I	GTNNAC	3 cut(s)	42, 56, 935
Hpy99I	CGWCG	1 cut(s)	265
HpyAV	CCTTC	4 cut(s)	388, 643, 898, 996
HpyCH4III	ACNGT	5 cut(s)	300, 402, 541, 568, 925
HpyCH4V	TGCA	7 cut(s)	394, 477, 667, 716, 842, 930, 998
HpyF10VI	GCNNNNNNNGC	3 cut(s)	149, 325, 858
HpyF3I	CTNAG	5 cut(s)	222, 418, 768, 810, 987
Hsp92II	CATG	2 cut(s)	125, 842
Kzo9I	GATC	2 cut(s)	22, 676
LmnI	GCTCC	3 cut(s)	90, 211, 375
Lsp1109I	GCAGC	4 cut(s)	97, 378, 727, 870
LweI	GCATC	4 cut(s)	152, 703, 851, 985
MaeI	CTAG	5 cut(s)	432, 438, 683, 696, 954
MaeIII	GTNAC	2 cut(s)	616, 919
MalI	GATC	2 cut(s)	24, 678
MboI	GATC	2 cut(s)	22, 676
MboII	GAAGA	2 cut(s)	113, 800
MflI	RGATCY	1 cut(s)	22
MhlI	GDGCHC	1 cut(s)	988
MluCI	AATT	7 cut(s)	71, 200, 457, 509, 719, 878, 1014
MlyI	GAGTC	1 cut(s)	304
MmeI	TCCRAC	1 cut(s)	189
Mph1103I	ATGCAT	1 cut(s)	844
MseI	TTAA	7 cut(s)	404, 512, 533, 600, 609, 816, 965
MslI	CAYNNNNRTG	1 cut(s)	49
MspA1I	CMGCKG	2 cut(s)	49, 110
MspCI	CTTAAG	1 cut(s)	608
MspI	CCGG	2 cut(s)	161, 254
MwoI	GCNNNNNNNGC	3 cut(s)	149, 325, 858
NdeII	GATC	2 cut(s)	22, 676
NlaIII	CATG	2 cut(s)	125, 842
NlaIV	GGNNCC	1 cut(s)	371
NmuCI	GTSAC	1 cut(s)	616
NsiI	ATGCAT	1 cut(s)	844
NspI	RCATGY	1 cut(s)	842
OliI	CACNNNNGTG	1 cut(s)	49
PagI	TCATGA	1 cut(s)	121
PfeI	GAWTC	1 cut(s)	266
PinAI	ACCGGT	1 cut(s)	160
PkrI	GCNGC	7 cut(s)	112, 154, 234, 237, 393, 742, 860
PleI	GAGTC	1 cut(s)	304
PpsI	GAGTC	1 cut(s)	304
PspN4I	GGNNCC	1 cut(s)	371
PsuI	RGATCY	1 cut(s)	22
PvuII	CAGCTG	1 cut(s)	110
RseI	CAYNNNNRTG	1 cut(s)	49
SaqAI	TTAA	7 cut(s)	404, 512, 533, 600, 609, 816, 965
SatI	GCNGC	7 cut(s)	111, 153, 233, 236, 392, 741, 859
Sau3AI	GATC	2 cut(s)	22, 676
SchI	GAGTC	1 cut(s)	304
SduI	GDGCHC	1 cut(s)	988
SfaNI	GCATC	4 cut(s)	152, 703, 851, 985
SfcI	CTRYAG	1 cut(s)	853
SmiMI	CAYNNNNRTG	1 cut(s)	49
SmlI	CTYRAG	2 cut(s)	608, 938
SmoI	CTYRAG	2 cut(s)	608, 938
Sse9I	AATT	7 cut(s)	71, 200, 457, 509, 719, 878, 1014
SsiI	CCGC	5 cut(s)	47, 152, 233, 236, 319
SspI	AATATT	1 cut(s)	35
SspMI	CTAG	5 cut(s)	432, 438, 683, 696, 954
TaaI	ACNGT	5 cut(s)	300, 402, 541, 568, 925
TaqI	TCGA	3 cut(s)	8, 93, 747
TasI	AATT	7 cut(s)	71, 200, 457, 509, 719, 878, 1014
TauI	GCSGC	3 cut(s)	155, 235, 238
TfiI	GAWTC	1 cut(s)	266
Tru1I	TTAA	7 cut(s)	404, 512, 533, 600, 609, 816, 965
Tru9I	TTAA	7 cut(s)	404, 512, 533, 600, 609, 816, 965
TscAI	CASTG	2 cut(s)	498, 868
TseFI	GTSAC	1 cut(s)	616
TseI	GCWGC	4 cut(s)	110, 391, 740, 858
Tsp45I	GTSAC	1 cut(s)	616
TspDTI	ATGAA	3 cut(s)	95, 138, 722
TspGWI	ACGGA	1 cut(s)	278
TspRI	CASTG	2 cut(s)	498, 868
Vha464I	CTTAAG	1 cut(s)	608
XapI	RAATTY	1 cut(s)	1014
XceI	RCATGY	1 cut(s)	842
XspI	CTAG	5 cut(s)	432, 438, 683, 696, 954
Zsp2I	ATGCAT	1 cut(s)	844

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.