Rh3CG361400

OTU domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Reverse (-)
44887115 .. 44887876
762 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG361400.1

Sequence Viewer

Length: 561 bp
ATGTCTGCTGGGAGTGATGTGCAACTTGGAACAATGATTGTTGTTGCCATCGACAAGGCTGGACAAAAAGCTAAGAAAAAGCAAGTGGATGAAGAGATTTCTCAACTTTCTACTGAGCTTAAAGAAAAACAAGCTAAAGAACTTGCATTATTAAGCTATAGCAACACTAGCAATGGAGGTGAACCGAGTAATCTGGATACTTTAATGAAGGTCATCGCTGGTGTTTCTATGAGCAGTCACCTTGAGAATGTAAAGCTTAGCAAGAGTTCAAGGAAAAAAGTGAAAAGGGCTCAAGAGGATGCAAGAAGGAAGCAGAGAATTCAAGAAGAGCAGAGCAATTCAATAAGCAATCAAATGGTCGAAGATGAGAAACTAGGAAAAAGGCTTGAACCCCTTGATGTGACAATTAATGAGATAAAGGTTAGTGGTCTTTGCCTCTATCGTGTTATCCAGGATCATCTAGCCCACCTTTTGGGAGGCTCTTCACCTTACTCATACCAAGGGCTTCGAGAAATGGTGGCTGTTTATATGTGTCATGTACCTGAGTTCCCATCTTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

186

Amino Acids

20.65

Weight (kDa)

8.44

Isoelectric Point (pI)

50.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 472
AclWI GGATC 1 cut(s) 462
AcsI RAATTY 1 cut(s) 318
AfaI GTAC 1 cut(s) 540
AfiI CCNNNNNNNGG 1 cut(s) 472
AgsI TTSAA 4 cut(s) 270, 323, 342, 389
AjnI CCWGG 1 cut(s) 450
AluBI AGCT 5 cut(s) 71, 118, 134, 156, 256
AluI AGCT 5 cut(s) 71, 118, 134, 156, 256
AlwI GGATC 1 cut(s) 462
ApoI RAATTY 1 cut(s) 318
AseI ATTAAT 1 cut(s) 408
AsuHPI GGTGA 3 cut(s) 191, 230, 477
BanII GRGCYC 1 cut(s) 292
BccI CCATC 2 cut(s) 56, 559
BciT130I CCWGG 1 cut(s) 452
BciVI GTATCC 1 cut(s) 190
BfaI CTAG 4 cut(s) 168, 374, 461, 559
BfmI CTRYAG 1 cut(s) 157
BfuI GTATCC 1 cut(s) 190
BlpI GCTNAGC 1 cut(s) 257
Bme1390I CCNGG 1 cut(s) 452
BmrFI CCNGG 1 cut(s) 452
BmsI GCATC 1 cut(s) 289
Bpu1102I GCTNAGC 1 cut(s) 257
BpuEI CTTGAG 2 cut(s) 263, 276
BsaJI CCNNGG 1 cut(s) 499
Bsc4I CCNNNNNNNGG 1 cut(s) 472
Bse3DI GCAATG 1 cut(s) 178
BseBI CCWGG 1 cut(s) 452
BseDI CCNNGG 1 cut(s) 499
BseGI GGATG 2 cut(s) 94, 304
BseLI CCNNNNNNNGG 1 cut(s) 472
BseMI GCAATG 1 cut(s) 178
BseMII CTCAG 2 cut(s) 105, 534
BseYI CCCAGC 1 cut(s) 8
BslI CCNNNNNNNGG 1 cut(s) 472
Bsp1286I GDGCHC 1 cut(s) 292
Bsp143I GATC 1 cut(s) 454
Bsp1720I GCTNAGC 1 cut(s) 257
BspCNI CTCAG 2 cut(s) 106, 535
BspPI GGATC 1 cut(s) 462
BspQI GCTCTTC 2 cut(s) 321, 487
BsrDI GCAATG 1 cut(s) 178
BssECI CCNNGG 1 cut(s) 499
BssMI GATC 1 cut(s) 454
BssT1I CCWWGG 1 cut(s) 499
Bst2UI CCWGG 1 cut(s) 452
Bst6I CTCTTC 3 cut(s) 87, 321, 487
BstDEI CTNAG 4 cut(s) 72, 114, 257, 543
BstF5I GGATG 2 cut(s) 94, 304
BstKTI GATC 1 cut(s) 457
BstMBI GATC 1 cut(s) 454
BstMWI GCNNNNNNNGC 1 cut(s) 168
BstNI CCWGG 1 cut(s) 452
BstSCI CCNGG 1 cut(s) 450
BstSFI CTRYAG 1 cut(s) 157
BsuI GTATCC 1 cut(s) 190
BtgZI GCGATG 1 cut(s) 199
BtsCI GGATG 2 cut(s) 94, 304
Csp6I GTAC 1 cut(s) 539
CviAII CATG 1 cut(s) 536
CviQI GTAC 1 cut(s) 539
DdeI CTNAG 4 cut(s) 72, 114, 257, 543
DpnI GATC 1 cut(s) 456
DpnII GATC 1 cut(s) 454
Eam1104I CTCTTC 3 cut(s) 87, 321, 487
EarI CTCTTC 3 cut(s) 87, 321, 487
Eco130I CCWWGG 1 cut(s) 499
Eco24I GRGCYC 1 cut(s) 292
EcoRI GAATTC 1 cut(s) 318
EcoRII CCWGG 1 cut(s) 450
EcoT14I CCWWGG 1 cut(s) 499
EcoT38I GRGCYC 1 cut(s) 292
ErhI CCWWGG 1 cut(s) 499
FaeI CATG 1 cut(s) 539
FaiI YATR 6 cut(s) 159, 230, 496, 528, 530, 537
FatI CATG 1 cut(s) 535
FokI GGATG 2 cut(s) 101, 311
FriOI GRGCYC 1 cut(s) 292
FspBI CTAG 4 cut(s) 168, 374, 461, 559
GsaI CCCAGC 1 cut(s) 12
Hin1II CATG 1 cut(s) 539
HindIII AAGCTT 1 cut(s) 254
HphI GGTGA 3 cut(s) 191, 230, 477
Hpy166II GTNNAC 1 cut(s) 182
Hpy188III TCNNGA 4 cut(s) 194, 293, 323, 509
Hpy8I GTNNAC 1 cut(s) 182
HpyAV CCTTC 2 cut(s) 202, 300
HpyCH4V TGCA 3 cut(s) 22, 146, 302
HpyF10VI GCNNNNNNNGC 1 cut(s) 168
HpyF3I CTNAG 4 cut(s) 72, 114, 257, 543
Hsp92II CATG 1 cut(s) 539
Kzo9I GATC 1 cut(s) 454
LguI GCTCTTC 2 cut(s) 321, 487
LpnPI CCDG 6 cut(s) 45, 179, 204, 437, 464, 555
LweI GCATC 1 cut(s) 289
MaeI CTAG 4 cut(s) 168, 374, 461, 559
MaeIII GTNAC 2 cut(s) 236, 400
MalI GATC 1 cut(s) 456
MboI GATC 1 cut(s) 454
MboII GAAGA 4 cut(s) 104, 338, 374, 474
MhlI GDGCHC 1 cut(s) 292
MluCI AATT 3 cut(s) 318, 337, 405
MnlI CCTC 4 cut(s) 170, 289, 446, 470
MseI TTAA 4 cut(s) 120, 152, 203, 408
MspR9I CCNGG 1 cut(s) 452
MvaI CCWGG 1 cut(s) 452
MwoI GCNNNNNNNGC 1 cut(s) 168
NdeII GATC 1 cut(s) 454
NlaIII CATG 1 cut(s) 539
NmuCI GTSAC 2 cut(s) 236, 400
PciSI GCTCTTC 2 cut(s) 321, 487
PflMI CCANNNNNTGG 1 cut(s) 472
PfoI TCCNGGA 1 cut(s) 450
PshBI ATTAAT 1 cut(s) 408
Psp6I CCWGG 1 cut(s) 450
PspFI CCCAGC 1 cut(s) 8
PspGI CCWGG 1 cut(s) 450
RsaI GTAC 1 cut(s) 540
RsaNI GTAC 1 cut(s) 539
SapI GCTCTTC 2 cut(s) 321, 487
SaqAI TTAA 4 cut(s) 120, 152, 203, 408
Sau3AI GATC 1 cut(s) 454
ScrFI CCNGG 1 cut(s) 452
SduI GDGCHC 1 cut(s) 292
SfaNI GCATC 1 cut(s) 289
SfcI CTRYAG 1 cut(s) 157
SmlI CTYRAG 2 cut(s) 242, 291
SmoI CTYRAG 2 cut(s) 242, 291
Sse9I AATT 3 cut(s) 318, 337, 405
SspMI CTAG 4 cut(s) 168, 374, 461, 559
StyD4I CCNGG 1 cut(s) 450
StyI CCWWGG 1 cut(s) 499
TaqI TCGA 3 cut(s) 51, 360, 508
TasI AATT 3 cut(s) 318, 337, 405
Tru1I TTAA 4 cut(s) 120, 152, 203, 408
Tru9I TTAA 4 cut(s) 120, 152, 203, 408
TseFI GTSAC 2 cut(s) 236, 400
Tsp45I GTSAC 2 cut(s) 236, 400
TspDTI ATGAA 2 cut(s) 105, 221
Van91I CCANNNNNTGG 1 cut(s) 472
VspI ATTAAT 1 cut(s) 408
XapI RAATTY 1 cut(s) 318
XspI CTAG 4 cut(s) 168, 374, 461, 559
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.