Rmu_sc0000391.1_g000019

OTU domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000391.1
Physical Location & Seq
Reverse (-)
69236 .. 69568
333 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000391.1_g000019.1.cds

Sequence Viewer

Length: 333 bp
atgtctgctatgaatgatgcacaatttggaacaatgattattgctgctatcgacaaggctggacaaaatgctaagaaaaagcaagtggaggaagagatttctcaactttctactgagcttaaagaaaaacaagctaaagaacatgcatcattgagctatagcagcactgacaatggaggtgaattgagtaatctggatactttagtgaaggtcatagctggtgttattgtatgcagtcaacttgagaatgtaaagcctagcaagattttaaagaaaaaagtaaaaagggctcaggaggatgcaagaaggaagcagagaattcaagaagagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.17

Weight (kDa)

9.01

Isoelectric Point (pI)

42.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 318
AgsI TTSAA 1 cut(s) 323
AluBI AGCT 4 cut(s) 118, 134, 156, 218
AluI AGCT 4 cut(s) 118, 134, 156, 218
ApeKI GCWGC 2 cut(s) 44, 162
ApoI RAATTY 1 cut(s) 318
AsuHPI GGTGA 1 cut(s) 191
BaeI ACNNNNGTAYC 2 cut(s) 189, 222
BanII GRGCYC 1 cut(s) 292
BbvI GCAGC 2 cut(s) 31, 174
BciVI GTATCC 1 cut(s) 190
BfaI CTAG 1 cut(s) 258
BfmI CTRYAG 1 cut(s) 157
BfuI GTATCC 1 cut(s) 190
BisI GCNGC 2 cut(s) 45, 163
BlsI GCNGC 2 cut(s) 46, 164
BmsI GCATC 3 cut(s) 7, 155, 289
Bpu10I CCTNAGC 1 cut(s) 291
BpuEI CTTGAG 1 cut(s) 263
BseGI GGATG 1 cut(s) 304
BseMII CTCAG 2 cut(s) 105, 305
BseXI GCAGC 2 cut(s) 31, 174
Bsp1286I GDGCHC 1 cut(s) 292
BspCNI CTCAG 2 cut(s) 106, 304
Bst6I CTCTTC 2 cut(s) 87, 321
BstDEI CTNAG 3 cut(s) 72, 114, 291
BstF5I GGATG 1 cut(s) 304
BstMWI GCNNNNNNNGC 1 cut(s) 162
BstNSI RCATGY 1 cut(s) 146
BstSFI CTRYAG 1 cut(s) 157
BstV1I GCAGC 2 cut(s) 31, 174
BsuI GTATCC 1 cut(s) 190
BtsCI GGATG 1 cut(s) 304
BtsIMutI CAGTG 1 cut(s) 165
CviAII CATG 1 cut(s) 143
CviJI RGCY 7 cut(s) 59, 118, 134, 156, 218, 256, 290
CviKI_1 RGCY 7 cut(s) 59, 118, 134, 156, 218, 256, 290
DdeI CTNAG 3 cut(s) 72, 114, 291
DraI TTTAAA 1 cut(s) 270
Eam1104I CTCTTC 2 cut(s) 87, 321
EarI CTCTTC 2 cut(s) 87, 321
Eco24I GRGCYC 1 cut(s) 292
EcoRI GAATTC 1 cut(s) 318
EcoT22I ATGCAT 1 cut(s) 148
EcoT38I GRGCYC 1 cut(s) 292
FaeI CATG 1 cut(s) 146
FaiI YATR 5 cut(s) 11, 144, 159, 215, 232
FatI CATG 1 cut(s) 142
Fnu4HI GCNGC 2 cut(s) 45, 163
FokI GGATG 1 cut(s) 311
FriOI GRGCYC 1 cut(s) 292
Fsp4HI GCNGC 2 cut(s) 45, 163
FspBI CTAG 1 cut(s) 258
GluI GCNGC 2 cut(s) 45, 163
Hin1II CATG 1 cut(s) 146
HincII GTYRAC 1 cut(s) 239
HindII GTYRAC 1 cut(s) 239
HphI GGTGA 1 cut(s) 191
Hpy166II GTNNAC 1 cut(s) 239
Hpy188III TCNNGA 3 cut(s) 194, 293, 323
Hpy8I GTNNAC 1 cut(s) 239
HpyAV CCTTC 2 cut(s) 202, 300
HpyCH4V TGCA 4 cut(s) 20, 146, 234, 302
HpyF10VI GCNNNNNNNGC 1 cut(s) 162
HpyF3I CTNAG 3 cut(s) 72, 114, 291
Hsp92II CATG 1 cut(s) 146
LpnPI CCDG 4 cut(s) 45, 179, 204, 278
Lsp1109I GCAGC 2 cut(s) 31, 174
LweI GCATC 3 cut(s) 7, 155, 289
MaeI CTAG 1 cut(s) 258
MboII GAAGA 1 cut(s) 104
MhlI GDGCHC 1 cut(s) 292
MluCI AATT 3 cut(s) 23, 182, 318
MnlI CCTC 3 cut(s) 82, 170, 289
Mph1103I ATGCAT 1 cut(s) 148
MseI TTAA 2 cut(s) 120, 269
MwoI GCNNNNNNNGC 1 cut(s) 162
NlaIII CATG 1 cut(s) 146
NsiI ATGCAT 1 cut(s) 148
NspI RCATGY 1 cut(s) 146
PkrI GCNGC 2 cut(s) 46, 164
SaqAI TTAA 2 cut(s) 120, 269
SatI GCNGC 2 cut(s) 45, 163
SduI GDGCHC 1 cut(s) 292
SetI ASST 6 cut(s) 120, 136, 158, 181, 213, 220
SfaNI GCATC 3 cut(s) 7, 155, 289
SfcI CTRYAG 1 cut(s) 157
SmlI CTYRAG 1 cut(s) 242
SmoI CTYRAG 1 cut(s) 242
Sse9I AATT 3 cut(s) 23, 182, 318
SspMI CTAG 1 cut(s) 258
TaqI TCGA 1 cut(s) 51
TasI AATT 3 cut(s) 23, 182, 318
Tru1I TTAA 2 cut(s) 120, 269
Tru9I TTAA 2 cut(s) 120, 269
TscAI CASTG 1 cut(s) 172
TseI GCWGC 2 cut(s) 44, 162
TspDTI ATGAA 1 cut(s) 26
TspRI CASTG 1 cut(s) 172
XapI RAATTY 1 cut(s) 318
XceI RCATGY 1 cut(s) 146
XspI CTAG 1 cut(s) 258
Zsp2I ATGCAT 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.