RchiOBHm_Chr6g0282561

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
45804368 .. 45808049
3682 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25334

Sequence Viewer

Length: 186 bp
ATGGACTCGAAGATGGAAAACGGTTTGGAGATGGAGTCATGCCTGGGTCTTCAACTAGGAGGAAACTCTCAATATTTGAAGCTTGAAATTTGCCATATTGCTTCTCTTTGTGAGAAATTGGGATTTCCAGCAGAAGGCTTTCGATCCTTGCTATTGGTCACTGTTCTCTATAGGCCCCAGTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.86

Weight (kDa)

5.13

Isoelectric Point (pI)

62.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 138
AcsI RAATTY 1 cut(s) 87
AfiI CCNNNNNNNGG 1 cut(s) 134
AgsI TTSAA 3 cut(s) 53, 79, 86
AjnI CCWGG 1 cut(s) 42
AluBI AGCT 1 cut(s) 82
AluI AGCT 1 cut(s) 82
AlwI GGATC 1 cut(s) 138
AoxI GGCC 1 cut(s) 173
ApoI RAATTY 1 cut(s) 87
Asp700I GAANNNNTTC 1 cut(s) 138
AspS9I GGNCC 1 cut(s) 174
BbsI GAAGAC 1 cut(s) 41
BccI CCATC 2 cut(s) 7, 25
BciT130I CCWGG 1 cut(s) 44
BfaI CTAG 1 cut(s) 56
BfmI CTRYAG 1 cut(s) 169
Bme1390I CCNGG 1 cut(s) 44
BmgT120I GGNCC 1 cut(s) 174
BmiI GGNNCC 1 cut(s) 176
BmrFI CCNGG 1 cut(s) 44
BmrI ACTGGG 1 cut(s) 172
BmuI ACTGGG 1 cut(s) 172
BpiI GAAGAC 1 cut(s) 41
BsaJI CCNNGG 1 cut(s) 43
BsaXI ACNNNNNCTCC 2 cut(s) 20, 50
Bsc4I CCNNNNNNNGG 1 cut(s) 134
Bse1I ACTGG 1 cut(s) 178
BseBI CCWGG 1 cut(s) 44
BseDI CCNNGG 1 cut(s) 43
BseLI CCNNNNNNNGG 1 cut(s) 134
BseNI ACTGG 1 cut(s) 178
BshFI GGCC 1 cut(s) 175
BslI CCNNNNNNNGG 1 cut(s) 134
BsnI GGCC 1 cut(s) 175
Bsp143I GATC 1 cut(s) 143
BspANI GGCC 1 cut(s) 175
BspLI GGNNCC 1 cut(s) 176
BspPI GGATC 1 cut(s) 138
BsrI ACTGG 1 cut(s) 178
BssECI CCNNGG 1 cut(s) 43
BssMI GATC 1 cut(s) 143
Bst2UI CCWGG 1 cut(s) 44
Bst4CI ACNGT 2 cut(s) 23, 163
BstKTI GATC 1 cut(s) 146
BstMBI GATC 1 cut(s) 143
BstNI CCWGG 1 cut(s) 44
BstSCI CCNGG 1 cut(s) 42
BstSFI CTRYAG 1 cut(s) 169
BstV2I GAAGAC 1 cut(s) 41
BsuRI GGCC 1 cut(s) 175
BtsIMutI CAGTG 2 cut(s) 159, 185
Cfr13I GGNCC 1 cut(s) 174
CviAII CATG 1 cut(s) 39
CviJI RGCY 3 cut(s) 82, 138, 175
CviKI_1 RGCY 3 cut(s) 82, 138, 175
DpnI GATC 1 cut(s) 145
DpnII GATC 1 cut(s) 143
EcoO109I RGGNCCY 1 cut(s) 174
EcoRII CCWGG 1 cut(s) 42
FaeI CATG 1 cut(s) 42
FaiI YATR 3 cut(s) 40, 96, 171
FatI CATG 1 cut(s) 38
FspBI CTAG 1 cut(s) 56
HaeIII GGCC 1 cut(s) 175
Hin1II CATG 1 cut(s) 42
HindIII AAGCTT 1 cut(s) 80
HinfI GANTC 2 cut(s) 5, 35
HpyAV CCTTC 1 cut(s) 128
HpyCH4III ACNGT 2 cut(s) 23, 163
Hsp92II CATG 1 cut(s) 42
Kzo9I GATC 1 cut(s) 143
LpnPI CCDG 3 cut(s) 29, 56, 141
MaeI CTAG 1 cut(s) 56
MaeIII GTNAC 1 cut(s) 157
MalI GATC 1 cut(s) 145
MboI GATC 1 cut(s) 143
MboII GAAGA 2 cut(s) 22, 41
MluCI AATT 2 cut(s) 87, 116
MlyI GAGTC 1 cut(s) 44
MnlI CCTC 1 cut(s) 53
MroXI GAANNNNTTC 1 cut(s) 138
MspR9I CCNGG 1 cut(s) 44
MvaI CCWGG 1 cut(s) 44
NdeII GATC 1 cut(s) 143
NlaIII CATG 1 cut(s) 42
NlaIV GGNNCC 1 cut(s) 176
NmuCI GTSAC 1 cut(s) 157
PdmI GAANNNNTTC 1 cut(s) 138
PleI GAGTC 1 cut(s) 43
PpsI GAGTC 1 cut(s) 43
Psp6I CCWGG 1 cut(s) 42
PspGI CCWGG 1 cut(s) 42
PspN4I GGNNCC 1 cut(s) 176
PspPI GGNCC 1 cut(s) 174
Sau3AI GATC 1 cut(s) 143
Sau96I GGNCC 1 cut(s) 174
SchI GAGTC 1 cut(s) 44
ScrFI CCNGG 1 cut(s) 44
SetI ASST 1 cut(s) 84
SfcI CTRYAG 1 cut(s) 169
SgeI CNNG 8 cut(s) 19, 51, 55, 56, 68, 95, 140, 160
Sse9I AATT 2 cut(s) 87, 116
SspI AATATT 1 cut(s) 74
SspMI CTAG 1 cut(s) 56
StyD4I CCNGG 1 cut(s) 42
TaaI ACNGT 2 cut(s) 23, 163
TaqI TCGA 2 cut(s) 8, 142
TasI AATT 2 cut(s) 87, 116
TscAI CASTG 2 cut(s) 166, 185
TseFI GTSAC 1 cut(s) 157
Tsp45I GTSAC 1 cut(s) 157
TspRI CASTG 2 cut(s) 166, 185
XapI RAATTY 1 cut(s) 87
XmnI GAANNNNTTC 1 cut(s) 138
XspI CTAG 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.