Rmu_co8332197.1_g000001

pre-mRNA-processing factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8332197.1
Physical Location & Seq
Forward (+)
1 .. 862
862 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8332197.1_g000001.1.cds

Sequence Viewer

Length: 312 bp
agacaaccagagattcacctttttgctgctcgcttcaaagagcaaagtggagatatccctggtgctcaggctgcttatcaactcgtacattctgaaatttcacctggtcttcttgaagcaatcattaagcatgcaaacatggaacaccgtctgggaaatatggaagctgcctactccttgtttgaacaggccattgccattgaaaaaggaaaggagcattctcagaccttacccgtgctgtttgctcaatacgcacggttcgcatacttggtaggttataagttatataataacctggcagcttggctatga

Protein Analysis

103

Amino Acids

11.62

Weight (kDa)

6.56

Isoelectric Point (pI)

37.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 279
AcsI RAATTY 1 cut(s) 96
AfaI GTAC 1 cut(s) 87
AgsI TTSAA 4 cut(s) 37, 116, 185, 203
AjnI CCWGG 3 cut(s) 58, 103, 294
AluBI AGCT 2 cut(s) 167, 302
AluI AGCT 2 cut(s) 167, 302
Alw21I GWGCWC 1 cut(s) 67
AoxI GGCC 1 cut(s) 189
ApeKI GCWGC 4 cut(s) 26, 71, 167, 299
ApoI RAATTY 1 cut(s) 96
AsuHPI GGTGA 2 cut(s) 8, 93
BbsI GAAGAC 1 cut(s) 101
Bbv12I GWGCWC 1 cut(s) 67
BbvI GCAGC 3 cut(s) 13, 58, 154
BciT130I CCWGG 3 cut(s) 60, 105, 296
BisI GCNGC 4 cut(s) 27, 72, 168, 300
BlsI GCNGC 4 cut(s) 28, 73, 169, 301
Bme1390I CCNGG 3 cut(s) 60, 105, 296
BmrFI CCNGG 3 cut(s) 60, 105, 296
BpiI GAAGAC 1 cut(s) 101
Bpu10I CCTNAGC 1 cut(s) 66
BsaJI CCNNGG 1 cut(s) 58
Bse3DI GCAATG 1 cut(s) 192
BseBI CCWGG 3 cut(s) 60, 105, 296
BseDI CCNNGG 1 cut(s) 58
BseMI GCAATG 1 cut(s) 192
BseMII CTCAG 2 cut(s) 80, 236
BseXI GCAGC 3 cut(s) 13, 58, 154
BshFI GGCC 1 cut(s) 191
BsiHKAI GWGCWC 1 cut(s) 67
BsmI GAATGC 1 cut(s) 217
BsnI GGCC 1 cut(s) 191
Bsp1286I GDGCHC 1 cut(s) 67
BspANI GGCC 1 cut(s) 191
BspCNI CTCAG 2 cut(s) 79, 235
BsrDI GCAATG 1 cut(s) 192
BssECI CCNNGG 1 cut(s) 58
Bst2UI CCWGG 3 cut(s) 60, 105, 296
Bst4CI ACNGT 2 cut(s) 149, 258
BstC8I GCNNGC 2 cut(s) 31, 132
BstDEI CTNAG 2 cut(s) 66, 222
BstMWI GCNNNNNNNGC 3 cut(s) 71, 251, 260
BstNI CCWGG 3 cut(s) 60, 105, 296
BstNSI RCATGY 1 cut(s) 134
BstSCI CCNGG 3 cut(s) 58, 103, 294
BstV1I GCAGC 3 cut(s) 13, 58, 154
BstV2I GAAGAC 1 cut(s) 101
BsuRI GGCC 1 cut(s) 191
Cac8I GCNNGC 2 cut(s) 31, 132
CsiI ACCWGGT 1 cut(s) 103
Csp6I GTAC 1 cut(s) 86
CviAII CATG 2 cut(s) 131, 139
CviJI RGCY 5 cut(s) 71, 167, 191, 302, 307
CviKI_1 RGCY 5 cut(s) 71, 167, 191, 302, 307
CviQI GTAC 1 cut(s) 86
DdeI CTNAG 2 cut(s) 66, 222
Eco32I GATATC 1 cut(s) 55
EcoRII CCWGG 3 cut(s) 58, 103, 294
EcoRV GATATC 1 cut(s) 55
FaeI CATG 2 cut(s) 134, 142
FaiI YATR 8 cut(s) 132, 140, 161, 265, 279, 286, 288, 310
FatI CATG 2 cut(s) 130, 138
Fnu4HI GCNGC 4 cut(s) 27, 72, 168, 300
Fsp4HI GCNGC 4 cut(s) 27, 72, 168, 300
GluI GCNGC 4 cut(s) 27, 72, 168, 300
HaeIII GGCC 1 cut(s) 191
Hin1II CATG 2 cut(s) 134, 142
HinfI GANTC 1 cut(s) 13
HphI GGTGA 2 cut(s) 8, 93
Hpy188I TCNGA 2 cut(s) 94, 225
Hpy188III TCNNGA 1 cut(s) 113
HpyCH4III ACNGT 2 cut(s) 149, 258
HpyCH4V TGCA 1 cut(s) 134
HpyF10VI GCNNNNNNNGC 3 cut(s) 71, 251, 260
HpyF3I CTNAG 2 cut(s) 66, 222
Hsp92II CATG 2 cut(s) 134, 142
LmnI GCTCC 1 cut(s) 214
Lsp1109I GCAGC 3 cut(s) 13, 58, 154
MabI ACCWGGT 1 cut(s) 103
MboII GAAGA 1 cut(s) 101
MhlI GDGCHC 1 cut(s) 67
MluCI AATT 1 cut(s) 96
MseI TTAA 1 cut(s) 126
MspR9I CCNGG 3 cut(s) 60, 105, 296
Mva1269I GAATGC 1 cut(s) 217
MvaI CCWGG 3 cut(s) 60, 105, 296
MwoI GCNNNNNNNGC 3 cut(s) 71, 251, 260
NlaIII CATG 2 cut(s) 134, 142
NspI RCATGY 1 cut(s) 134
PaeI GCATGC 1 cut(s) 134
PctI GAATGC 1 cut(s) 217
PfeI GAWTC 1 cut(s) 13
PkrI GCNGC 4 cut(s) 28, 73, 169, 301
PsiI TTATAA 1 cut(s) 279
Psp6I CCWGG 3 cut(s) 58, 103, 294
PspGI CCWGG 3 cut(s) 58, 103, 294
RsaI GTAC 1 cut(s) 87
RsaNI GTAC 1 cut(s) 86
SaqAI TTAA 1 cut(s) 126
SatI GCNGC 4 cut(s) 27, 72, 168, 300
ScrFI CCNGG 3 cut(s) 60, 105, 296
SduI GDGCHC 1 cut(s) 67
SetI ASST 7 cut(s) 21, 106, 169, 230, 277, 297, 304
SexAI ACCWGGT 1 cut(s) 103
SphI GCATGC 1 cut(s) 134
Sse9I AATT 1 cut(s) 96
StyD4I CCNGG 3 cut(s) 58, 103, 294
TaaI ACNGT 2 cut(s) 149, 258
TasI AATT 1 cut(s) 96
TfiI GAWTC 1 cut(s) 13
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TseI GCWGC 4 cut(s) 26, 71, 167, 299
XapI RAATTY 1 cut(s) 96
XceI RCATGY 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.