Rmu_sc0001468.1_g000022

pre-mRNA-processing factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001468.1
Physical Location & Seq
Forward (+)
106854 .. 108791
1938 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001468.1_g000022.1.cds

Sequence Viewer

Length: 459 bp
atggactcgaagacggaaaacgttttggagatggagtcatgcctgggtcttcaactaggaggaaactctcaatgtttgaagcttgaaatttgccatattgcttctctttgtgagaaattggctatgtctgccgaagaagatagactatggaacattgtgagggctaattctttagattttaatgcctggactgctttaattgaagagacagagaaggtggcagaggataacatcttaaaaattcaaaaagtttatgatgcttttctagcagagtttcctttgtgttatgggtattggaaaaagtatgcagatcatgaggcacattttggtgttattgataaagttgtggaggtttatgaacgagcagttcaagctgttacctattcagttgacatttggttgcactactgcacaattgccacaactacttttggagatccagacactatcagaaggtaa

Protein Analysis

152

Amino Acids

17.39

Weight (kDa)

4.71

Isoelectric Point (pI)

50.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 21
AclWI GGATC 1 cut(s) 431
AcsI RAATTY 2 cut(s) 87, 240
AgsI TTSAA 6 cut(s) 53, 79, 86, 203, 245, 371
AjnI CCWGG 2 cut(s) 42, 185
AluBI AGCT 2 cut(s) 82, 374
AluI AGCT 2 cut(s) 82, 374
Alw26I GTCTC 1 cut(s) 200
AlwI GGATC 1 cut(s) 431
ApoI RAATTY 2 cut(s) 87, 240
BbsI GAAGAC 2 cut(s) 17, 41
BccI CCATC 1 cut(s) 25
BciT130I CCWGG 2 cut(s) 44, 187
BcoDI GTCTC 1 cut(s) 200
BfaI CTAG 2 cut(s) 56, 266
Bme1390I CCNGG 2 cut(s) 44, 187
BmrFI CCNGG 2 cut(s) 44, 187
BmsI GCATC 1 cut(s) 247
BpiI GAAGAC 2 cut(s) 17, 41
BsaJI CCNNGG 1 cut(s) 43
BsaXI ACNNNNNCTCC 2 cut(s) 20, 50
BseBI CCWGG 2 cut(s) 44, 187
BseDI CCNNGG 1 cut(s) 43
BsgI GTGCAG 1 cut(s) 394
BsmAI GTCTC 1 cut(s) 200
Bsp143I GATC 2 cut(s) 310, 436
BspHI TCATGA 1 cut(s) 313
BspPI GGATC 1 cut(s) 431
BssECI CCNNGG 1 cut(s) 43
BssMI GATC 2 cut(s) 310, 436
Bst2UI CCWGG 2 cut(s) 44, 187
Bst6I CTCTTC 1 cut(s) 198
BstKTI GATC 2 cut(s) 313, 439
BstMAI GTCTC 1 cut(s) 200
BstMBI GATC 2 cut(s) 310, 436
BstMWI GCNNNNNNNGC 4 cut(s) 128, 191, 266, 371
BstNI CCWGG 2 cut(s) 44, 187
BstSCI CCNGG 2 cut(s) 42, 185
BstV2I GAAGAC 2 cut(s) 17, 41
BstX2I RGATCY 1 cut(s) 436
BstYI RGATCY 1 cut(s) 436
CciI TCATGA 1 cut(s) 313
CviAII CATG 2 cut(s) 39, 314
CviJI RGCY 4 cut(s) 82, 122, 164, 374
CviKI_1 RGCY 4 cut(s) 82, 122, 164, 374
DpnI GATC 2 cut(s) 312, 438
DpnII GATC 2 cut(s) 310, 436
Eam1104I CTCTTC 1 cut(s) 198
EarI CTCTTC 1 cut(s) 198
EcoRII CCWGG 2 cut(s) 42, 185
FaeI CATG 2 cut(s) 42, 317
FaiI YATR 9 cut(s) 40, 96, 125, 148, 255, 288, 306, 315, 357
FatI CATG 2 cut(s) 38, 313
FspBI CTAG 2 cut(s) 56, 266
Hin1II CATG 2 cut(s) 42, 317
HincII GTYRAC 1 cut(s) 391
HindII GTYRAC 1 cut(s) 391
HindIII AAGCTT 1 cut(s) 80
HinfI GANTC 2 cut(s) 5, 35
Hpy166II GTNNAC 1 cut(s) 391
Hpy188I TCNGA 1 cut(s) 452
Hpy188III TCNNGA 2 cut(s) 314, 440
Hpy8I GTNNAC 1 cut(s) 391
HpyAV CCTTC 2 cut(s) 208, 447
HpyCH4IV ACGT 1 cut(s) 21
HpyCH4V TGCA 3 cut(s) 308, 403, 411
HpyF10VI GCNNNNNNNGC 4 cut(s) 128, 191, 266, 371
HpySE526I ACGT 1 cut(s) 21
Hsp92II CATG 2 cut(s) 42, 317
Kzo9I GATC 2 cut(s) 310, 436
LpnPI CCDG 5 cut(s) 29, 56, 172, 199, 453
LweI GCATC 1 cut(s) 247
MaeI CTAG 2 cut(s) 56, 266
MaeII ACGT 1 cut(s) 21
MaeIII GTNAC 1 cut(s) 376
MalI GATC 2 cut(s) 312, 438
MboI GATC 2 cut(s) 310, 436
MboII GAAGA 5 cut(s) 22, 41, 146, 149, 215
MfeI CAATTG 1 cut(s) 414
MflI RGATCY 1 cut(s) 436
MluCI AATT 6 cut(s) 87, 116, 166, 198, 240, 414
MlyI GAGTC 1 cut(s) 44
MnlI CCTC 5 cut(s) 53, 153, 217, 310, 343
MseI TTAA 3 cut(s) 180, 197, 236
MslI CAYNNNNRTG 1 cut(s) 327
MspR9I CCNGG 2 cut(s) 44, 187
MunI CAATTG 1 cut(s) 414
MvaI CCWGG 2 cut(s) 44, 187
MwoI GCNNNNNNNGC 4 cut(s) 128, 191, 266, 371
NdeII GATC 2 cut(s) 310, 436
NlaIII CATG 2 cut(s) 42, 317
PagI TCATGA 1 cut(s) 313
PleI GAGTC 1 cut(s) 43
PpsI GAGTC 1 cut(s) 43
Psp1406I AACGTT 1 cut(s) 21
Psp6I CCWGG 2 cut(s) 42, 185
PspGI CCWGG 2 cut(s) 42, 185
PsuI RGATCY 1 cut(s) 436
RseI CAYNNNNRTG 1 cut(s) 327
SaqAI TTAA 3 cut(s) 180, 197, 236
Sau3AI GATC 2 cut(s) 310, 436
SchI GAGTC 1 cut(s) 44
ScrFI CCNGG 2 cut(s) 44, 187
SetI ASST 7 cut(s) 24, 84, 219, 354, 376, 383, 458
SfaNI GCATC 1 cut(s) 247
SmiMI CAYNNNNRTG 1 cut(s) 327
Sse9I AATT 6 cut(s) 87, 116, 166, 198, 240, 414
SspMI CTAG 2 cut(s) 56, 266
StyD4I CCNGG 2 cut(s) 42, 185
TaiI ACGT 1 cut(s) 24
TaqI TCGA 1 cut(s) 8
TasI AATT 6 cut(s) 87, 116, 166, 198, 240, 414
Tru1I TTAA 3 cut(s) 180, 197, 236
Tru9I TTAA 3 cut(s) 180, 197, 236
TspDTI ATGAA 1 cut(s) 372
TspGWI ACGGA 1 cut(s) 29
XapI RAATTY 2 cut(s) 87, 240
XspI CTAG 2 cut(s) 56, 266
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.