Rw5G035150

pre-mRNA-processing factor

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Forward (+)
60708005 .. 60709321
1317 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G035150.1

Sequence Viewer

Length: 405 bp
ATGTCTGCTGAAGAAGATAAACTATGGAACATTGTGAGGGCTAATTCTTTAGATTTTAATGCCTGGACTGCTTTAATTGGAGAGACAGAGAAGGTGGCAGAGGATAACATCTTGAAAATTCGAAAAGTTTATGATGCTTTTCTAGCAGAGTTTCCTTTGTGTTATGGGTATTGGAAAAAGTATGCAGATCATGAGGCACGTTTTGGTGTTATTGATAAAGTTGTGGACGAGCAGTTCAAGCTGTTACCTATTCAGTTGACATTTGGTTGCATTACTGCACATTTGCCACAACTACTTTTGGAGATCCAGACACTATCAGAAGGTAATAACTATTCCTTATGCATTCTTATTGTTAGCATGTTGGGAGTTTATGATTGCATGGTTTTCTCTGGTGCAAAGAACTAG

Protein Analysis

134

Amino Acids

15.26

Weight (kDa)

4.83

Isoelectric Point (pI)

33.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HAT_PRP39_N PF23240 6 - 74 1.3e-24 PRP39 N-terminal HAT repeat
Suf PF05843 6 - 74 9e-08 Suppressor of forked protein (Suf)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 298
AcsI RAATTY 1 cut(s) 117
AcuI CTGAAG 1 cut(s) 30
AgsI TTSAA 2 cut(s) 115, 238
AjnI CCWGG 1 cut(s) 62
AloI GAACNNNNNNTCC 2 cut(s) 218, 250
AluBI AGCT 1 cut(s) 241
AluI AGCT 1 cut(s) 241
Alw26I GTCTC 1 cut(s) 77
AlwI GGATC 1 cut(s) 298
ApoI RAATTY 1 cut(s) 117
AsuII TTCGAA 1 cut(s) 121
BciT130I CCWGG 1 cut(s) 64
BcoDI GTCTC 1 cut(s) 77
BfaI CTAG 2 cut(s) 143, 403
Bme1390I CCNGG 1 cut(s) 64
BmrFI CCNGG 1 cut(s) 64
BmsI GCATC 1 cut(s) 124
Bpu14I TTCGAA 1 cut(s) 121
BseBI CCWGG 1 cut(s) 64
BsgI GTGCAG 1 cut(s) 261
BsmAI GTCTC 1 cut(s) 77
BsmI GAATGC 1 cut(s) 342
Bsp119I TTCGAA 1 cut(s) 121
Bsp143I GATC 2 cut(s) 187, 303
BspHI TCATGA 1 cut(s) 190
BspPI GGATC 1 cut(s) 298
BspT104I TTCGAA 1 cut(s) 121
BssMI GATC 2 cut(s) 187, 303
Bst2UI CCWGG 1 cut(s) 64
BstBI TTCGAA 1 cut(s) 121
BstKTI GATC 2 cut(s) 190, 306
BstMAI GTCTC 1 cut(s) 77
BstMBI GATC 2 cut(s) 187, 303
BstMWI GCNNNNNNNGC 3 cut(s) 68, 143, 238
BstNI CCWGG 1 cut(s) 64
BstNSI RCATGY 1 cut(s) 361
BstSCI CCNGG 1 cut(s) 62
BstX2I RGATCY 1 cut(s) 303
BstYI RGATCY 1 cut(s) 303
CciI TCATGA 1 cut(s) 190
CviAII CATG 3 cut(s) 191, 358, 379
CviJI RGCY 2 cut(s) 41, 241
CviKI_1 RGCY 2 cut(s) 41, 241
DpnI GATC 2 cut(s) 189, 305
DpnII GATC 2 cut(s) 187, 303
Eco57I CTGAAG 1 cut(s) 30
EcoRII CCWGG 1 cut(s) 62
EcoT22I ATGCAT 1 cut(s) 344
FaeI CATG 3 cut(s) 194, 361, 382
FaiI YATR 9 cut(s) 25, 132, 165, 183, 192, 340, 359, 372, 380
FatI CATG 3 cut(s) 190, 357, 378
FspBI CTAG 2 cut(s) 143, 403
Hin1II CATG 3 cut(s) 194, 361, 382
HincII GTYRAC 1 cut(s) 258
HindII GTYRAC 1 cut(s) 258
Hpy166II GTNNAC 2 cut(s) 226, 258
Hpy188I TCNGA 1 cut(s) 319
Hpy188III TCNNGA 3 cut(s) 112, 191, 307
Hpy8I GTNNAC 2 cut(s) 226, 258
HpyAV CCTTC 2 cut(s) 85, 314
HpyCH4IV ACGT 1 cut(s) 199
HpyCH4V TGCA 6 cut(s) 185, 270, 278, 342, 378, 395
HpyF10VI GCNNNNNNNGC 3 cut(s) 68, 143, 238
HpySE526I ACGT 1 cut(s) 199
Hsp92II CATG 3 cut(s) 194, 361, 382
Kzo9I GATC 2 cut(s) 187, 303
LpnPI CCDG 4 cut(s) 49, 76, 320, 375
LweI GCATC 1 cut(s) 124
MaeI CTAG 2 cut(s) 143, 403
MaeII ACGT 1 cut(s) 199
MaeIII GTNAC 1 cut(s) 243
MalI GATC 2 cut(s) 189, 305
MboI GATC 2 cut(s) 187, 303
MboII GAAGA 2 cut(s) 23, 26
MflI RGATCY 1 cut(s) 303
MluCI AATT 3 cut(s) 43, 75, 117
MnlI CCTC 3 cut(s) 30, 94, 187
Mph1103I ATGCAT 1 cut(s) 344
MseI TTAA 2 cut(s) 57, 74
MspR9I CCNGG 1 cut(s) 64
Mva1269I GAATGC 1 cut(s) 342
MvaI CCWGG 1 cut(s) 64
MwoI GCNNNNNNNGC 3 cut(s) 68, 143, 238
NdeII GATC 2 cut(s) 187, 303
NlaIII CATG 3 cut(s) 194, 361, 382
NsiI ATGCAT 1 cut(s) 344
NspI RCATGY 1 cut(s) 361
NspV TTCGAA 1 cut(s) 121
PagI TCATGA 1 cut(s) 190
PctI GAATGC 1 cut(s) 342
Psp6I CCWGG 1 cut(s) 62
PspGI CCWGG 1 cut(s) 62
PsuI RGATCY 1 cut(s) 303
SaqAI TTAA 2 cut(s) 57, 74
Sau3AI GATC 2 cut(s) 187, 303
ScrFI CCNGG 1 cut(s) 64
SetI ASST 5 cut(s) 96, 202, 243, 250, 325
SfaNI GCATC 1 cut(s) 124
SfuI TTCGAA 1 cut(s) 121
Sse9I AATT 3 cut(s) 43, 75, 117
SspMI CTAG 2 cut(s) 143, 403
StyD4I CCNGG 1 cut(s) 62
TaiI ACGT 1 cut(s) 202
TaqI TCGA 1 cut(s) 121
TasI AATT 3 cut(s) 43, 75, 117
Tru1I TTAA 2 cut(s) 57, 74
Tru9I TTAA 2 cut(s) 57, 74
XapI RAATTY 1 cut(s) 117
XceI RCATGY 1 cut(s) 361
XspI CTAG 2 cut(s) 143, 403
Zsp2I ATGCAT 1 cut(s) 344
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.