Rh5BG355000

pre-mRNA-processing factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
54941377 .. 54942710
1334 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG355000.1

Sequence Viewer

Length: 246 bp
ATGGCTTTCAAGCTTTTTGAGCAAGGATTGGCGTATGTTGGAACAGATTACTTGTCCTTTCCTCTTTGGGACAGGTACATTGATTATGAATTTATGCAGCAAGCATGGGGCCAGCTTGTTGTGATCTACTCACGAATATTAGAGAATCCGTACCAACAACTGGATCGATATTTAAACAGCATCTATAATACTTGTTGCTGTCGGACCCTGATCTTAGTAACTAGTTATGAGACATGTCAAAATTGA

Protein Analysis

81

Amino Acids

9.73

Weight (kDa)

4.51

Isoelectric Point (pI)

14.79

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HAT_PRP39_N PF23240 4 - 60 1.1e-14 PRP39 N-terminal HAT repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 160
AclWI GGATC 1 cut(s) 171
AcsI RAATTY 1 cut(s) 89
AfaI GTAC 2 cut(s) 77, 152
AfiI CCNNNNNNNGG 1 cut(s) 160
AflIII ACRYGT 1 cut(s) 233
AgsI TTSAA 1 cut(s) 10
AhlI ACTAGT 1 cut(s) 221
AluBI AGCT 2 cut(s) 13, 115
AluI AGCT 2 cut(s) 13, 115
Alw26I GTCTC 1 cut(s) 224
AlwI GGATC 1 cut(s) 171
AoxI GGCC 1 cut(s) 109
ApeKI GCWGC 1 cut(s) 97
ApoI RAATTY 1 cut(s) 89
AspS9I GGNCC 2 cut(s) 109, 204
AvaII GGWCC 1 cut(s) 204
BbvI GCAGC 1 cut(s) 109
BcoDI GTCTC 1 cut(s) 224
BcuI ACTAGT 1 cut(s) 221
BfaI CTAG 1 cut(s) 222
BisI GCNGC 1 cut(s) 98
BlsI GCNGC 1 cut(s) 99
Bme18I GGWCC 1 cut(s) 204
BmgT120I GGNCC 2 cut(s) 109, 204
BmiI GGNNCC 2 cut(s) 110, 206
BmsI GCATC 1 cut(s) 189
Bsa29I ATCGAT 1 cut(s) 166
Bsc4I CCNNNNNNNGG 1 cut(s) 160
Bse1I ACTGG 1 cut(s) 165
BseCI ATCGAT 1 cut(s) 166
BseLI CCNNNNNNNGG 1 cut(s) 160
BseNI ACTGG 1 cut(s) 165
BseXI GCAGC 1 cut(s) 109
BshFI GGCC 1 cut(s) 111
BshVI ATCGAT 1 cut(s) 166
BslFI GGGAC 1 cut(s) 83
BslI CCNNNNNNNGG 1 cut(s) 160
BsmAI GTCTC 1 cut(s) 224
BsmFI GGGAC 1 cut(s) 83
BsnI GGCC 1 cut(s) 111
Bsp143I GATC 3 cut(s) 123, 163, 210
BspANI GGCC 1 cut(s) 111
BspDI ATCGAT 1 cut(s) 166
BspLI GGNNCC 2 cut(s) 110, 206
BspPI GGATC 1 cut(s) 171
BsrI ACTGG 1 cut(s) 165
BssMI GATC 3 cut(s) 123, 163, 210
BstC8I GCNNGC 2 cut(s) 102, 113
BstDEI CTNAG 1 cut(s) 214
BstKTI GATC 3 cut(s) 126, 166, 213
BstMAI GTCTC 1 cut(s) 224
BstMBI GATC 3 cut(s) 123, 163, 210
BstMWI GCNNNNNNNGC 1 cut(s) 19
BstNSI RCATGY 1 cut(s) 237
BstV1I GCAGC 1 cut(s) 109
Bsu15I ATCGAT 1 cut(s) 166
BsuRI GGCC 1 cut(s) 111
BsuTUI ATCGAT 1 cut(s) 166
Cac8I GCNNGC 2 cut(s) 102, 113
Cfr13I GGNCC 2 cut(s) 109, 204
ClaI ATCGAT 1 cut(s) 166
Csp6I GTAC 2 cut(s) 76, 151
CviAII CATG 2 cut(s) 105, 234
CviJI RGCY 4 cut(s) 5, 13, 111, 115
CviKI_1 RGCY 4 cut(s) 5, 13, 111, 115
CviQI GTAC 2 cut(s) 76, 151
DdeI CTNAG 1 cut(s) 214
DpnI GATC 3 cut(s) 125, 165, 212
DpnII GATC 3 cut(s) 123, 163, 210
DraI TTTAAA 1 cut(s) 174
Eco47I GGWCC 1 cut(s) 204
FaeI CATG 2 cut(s) 108, 237
FaiI YATR 7 cut(s) 36, 87, 95, 106, 186, 228, 235
FaqI GGGAC 1 cut(s) 83
FatI CATG 2 cut(s) 104, 233
Fnu4HI GCNGC 1 cut(s) 98
Fsp4HI GCNGC 1 cut(s) 98
FspBI CTAG 1 cut(s) 222
GluI GCNGC 1 cut(s) 98
HaeIII GGCC 1 cut(s) 111
Hin1II CATG 2 cut(s) 108, 237
HindIII AAGCTT 1 cut(s) 11
HinfI GANTC 1 cut(s) 145
Hpy188I TCNGA 1 cut(s) 204
Hpy188III TCNNGA 1 cut(s) 132
HpyCH4V TGCA 1 cut(s) 97
HpyF10VI GCNNNNNNNGC 1 cut(s) 19
HpyF3I CTNAG 1 cut(s) 214
Hsp92II CATG 2 cut(s) 108, 237
Kzo9I GATC 3 cut(s) 123, 163, 210
LpnPI CCDG 4 cut(s) 58, 125, 146, 221
Lsp1109I GCAGC 1 cut(s) 109
LweI GCATC 1 cut(s) 189
MaeI CTAG 1 cut(s) 222
MaeIII GTNAC 1 cut(s) 217
MalI GATC 3 cut(s) 125, 165, 212
MboI GATC 3 cut(s) 123, 163, 210
MluCI AATT 2 cut(s) 89, 241
MmeI TCCRAC 2 cut(s) 19, 182
MnlI CCTC 1 cut(s) 72
MseI TTAA 1 cut(s) 173
MwoI GCNNNNNNNGC 1 cut(s) 19
NdeII GATC 3 cut(s) 123, 163, 210
NlaIII CATG 2 cut(s) 108, 237
NlaIV GGNNCC 2 cut(s) 110, 206
NspI RCATGY 1 cut(s) 237
PciI ACATGT 1 cut(s) 233
PfeI GAWTC 1 cut(s) 145
PflMI CCANNNNNTGG 1 cut(s) 160
PkrI GCNGC 1 cut(s) 99
PscI ACATGT 1 cut(s) 233
PspN4I GGNNCC 2 cut(s) 110, 206
PspPI GGNCC 2 cut(s) 109, 204
RsaI GTAC 2 cut(s) 77, 152
RsaNI GTAC 2 cut(s) 76, 151
SaqAI TTAA 1 cut(s) 173
SatI GCNGC 1 cut(s) 98
Sau3AI GATC 3 cut(s) 123, 163, 210
Sau96I GGNCC 2 cut(s) 109, 204
SetI ASST 3 cut(s) 15, 77, 117
SfaNI GCATC 1 cut(s) 189
SinI GGWCC 1 cut(s) 204
SpeI ACTAGT 1 cut(s) 221
Sse9I AATT 2 cut(s) 89, 241
SspI AATATT 1 cut(s) 138
SspMI CTAG 1 cut(s) 222
TaqI TCGA 1 cut(s) 166
TasI AATT 2 cut(s) 89, 241
TfiI GAWTC 1 cut(s) 145
Tru1I TTAA 1 cut(s) 173
Tru9I TTAA 1 cut(s) 173
TseI GCWGC 1 cut(s) 97
TspDTI ATGAA 1 cut(s) 102
TspGWI ACGGA 1 cut(s) 138
Van91I CCANNNNNTGG 1 cut(s) 160
VpaK11BI GGWCC 1 cut(s) 204
XapI RAATTY 1 cut(s) 89
XceI RCATGY 1 cut(s) 237
XspI CTAG 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.