RLG00000021962

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
Physical Location & Seq
Reverse (-)
79569994 .. 79589467
19474 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000021962

Sequence Viewer

Length: 408 bp
ATGGCCCTTAGAACTTTGCTGTTTCTGTTCTTCGCCATTCTCTTAGTTACTACAATGGTTTCAGCTGATGAGTTTGAGAACGAAAAGGCCAAGAAGCCAAAGGCATTGATTCACAGCGACGTGCAAACTCCACCACTTCCTCTAAACAAGGTTTACGATGACGAGAAAACTAATCTTCAGAATTTTATCGACTGGATCTGGAACATCCTCCCTAAACCTAAGCCAGAGACGCCGCCGAATTCGACCCCGAAAGTGCCGCAAAATCCGATGCCAAATGTGCCACCACCTACAAAAAAGACACCCCTATCACCACCACCGGAGAAAGAAGGAGAAGACGTTGGTAAAAGTAAGATTTCAGCTCCCCTCACTTCAAAACGACAACTTATTGGTTCCATCCCCTTTTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

136

Amino Acids

15.08

Weight (kDa)

9.01

Isoelectric Point (pI)

48.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 233, 257
AclWI GGATC 1 cut(s) 203
AcsI RAATTY 2 cut(s) 181, 238
AcuI CTGAAG 1 cut(s) 161
AcyI GRCGYC 1 cut(s) 230
AgsI TTSAA 1 cut(s) 372
AjiI CACGTC 1 cut(s) 121
AluBI AGCT 2 cut(s) 65, 359
AluI AGCT 2 cut(s) 65, 359
Alw26I GTCTC 1 cut(s) 221
AlwI GGATC 1 cut(s) 203
AoxI GGCC 2 cut(s) 3, 87
ApoI RAATTY 2 cut(s) 181, 238
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 300
BbsI GAAGAC 1 cut(s) 339
BccI CCATC 1 cut(s) 401
BcoDI GTCTC 1 cut(s) 221
BisI GCNGC 2 cut(s) 233, 257
BlsI GCNGC 2 cut(s) 234, 258
BmgBI CACGTC 1 cut(s) 121
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 391
BmsI GCATC 1 cut(s) 258
BpiI GAAGAC 1 cut(s) 339
Bpu10I CCTNAGC 1 cut(s) 219
BsaHI GRCGYC 1 cut(s) 230
BsaWI WCCGGW 1 cut(s) 316
BsaXI ACNNNNNCTCC 2 cut(s) 321, 351
Bse1I ACTGG 1 cut(s) 197
BseGI GGATG 2 cut(s) 204, 393
BseNI ACTGG 1 cut(s) 197
BshFI GGCC 2 cut(s) 5, 89
BsiSI CCGG 1 cut(s) 317
BsmAI GTCTC 1 cut(s) 221
BsmBI CGTCTC 1 cut(s) 221
BsnI GGCC 2 cut(s) 5, 89
Bsp143I GATC 1 cut(s) 195
BspACI CCGC 2 cut(s) 233, 257
BspANI GGCC 2 cut(s) 5, 89
BspLI GGNNCC 1 cut(s) 391
BspPI GGATC 1 cut(s) 203
BsrI ACTGG 1 cut(s) 197
BssMI GATC 1 cut(s) 195
BssNI GRCGYC 1 cut(s) 230
BstACI GRCGYC 1 cut(s) 230
BstDEI CTNAG 3 cut(s) 8, 43, 219
BstF5I GGATG 2 cut(s) 204, 393
BstKTI GATC 1 cut(s) 198
BstMAI GTCTC 1 cut(s) 221
BstMBI GATC 1 cut(s) 195
BstMWI GCNNNNNNNGC 2 cut(s) 229, 277
BstV2I GAAGAC 1 cut(s) 339
BstX2I RGATCY 1 cut(s) 195
BstYI RGATCY 1 cut(s) 195
BsuRI GGCC 2 cut(s) 5, 89
BtrI CACGTC 1 cut(s) 121
BtsCI GGATG 2 cut(s) 204, 393
Cfr13I GGNCC 1 cut(s) 4
CseI GACGC 1 cut(s) 238
CviJI RGCY 6 cut(s) 5, 65, 89, 97, 223, 359
CviKI_1 RGCY 6 cut(s) 5, 65, 89, 97, 223, 359
DdeI CTNAG 3 cut(s) 8, 43, 219
DpnI GATC 1 cut(s) 197
DpnII GATC 1 cut(s) 195
Eco57I CTGAAG 1 cut(s) 161
EcoRI GAATTC 1 cut(s) 238
Esp3I CGTCTC 1 cut(s) 221
Fnu4HI GCNGC 2 cut(s) 233, 257
FokI GGATG 2 cut(s) 191, 380
Fsp4HI GCNGC 2 cut(s) 233, 257
GluI GCNGC 2 cut(s) 233, 257
HaeIII GGCC 2 cut(s) 5, 89
HapII CCGG 1 cut(s) 317
HgaI GACGC 1 cut(s) 238
Hin1I GRCGYC 1 cut(s) 230
HinfI GANTC 1 cut(s) 109
HpaII CCGG 1 cut(s) 317
HphI GGTGA 1 cut(s) 300
Hpy166II GTNNAC 1 cut(s) 154
Hpy188I TCNGA 2 cut(s) 180, 267
Hpy188III TCNNGA 1 cut(s) 199
Hpy8I GTNNAC 1 cut(s) 154
Hpy99I CGWCG 1 cut(s) 122
HpyAV CCTTC 1 cut(s) 320
HpyCH4IV ACGT 2 cut(s) 120, 336
HpyCH4V TGCA 1 cut(s) 124
HpyF10VI GCNNNNNNNGC 2 cut(s) 229, 277
HpyF3I CTNAG 3 cut(s) 8, 43, 219
HpySE526I ACGT 2 cut(s) 120, 336
Hsp92I GRCGYC 1 cut(s) 230
Kzo9I GATC 1 cut(s) 195
LmnI GCTCC 1 cut(s) 364
LpnPI CCDG 4 cut(s) 178, 184, 237, 330
LweI GCATC 1 cut(s) 258
MaeII ACGT 2 cut(s) 120, 336
MaeIII GTNAC 1 cut(s) 46
MalI GATC 1 cut(s) 197
MboI GATC 1 cut(s) 195
MboII GAAGA 3 cut(s) 22, 167, 344
MflI RGATCY 1 cut(s) 195
MluCI AATT 2 cut(s) 181, 238
MnlI CCTC 3 cut(s) 150, 218, 374
MspA1I CMGCKG 1 cut(s) 65
MspI CCGG 1 cut(s) 317
MwoI GCNNNNNNNGC 2 cut(s) 229, 277
NdeII GATC 1 cut(s) 195
NlaIV GGNNCC 1 cut(s) 391
PfeI GAWTC 1 cut(s) 109
PkrI GCNGC 2 cut(s) 234, 258
PspN4I GGNNCC 1 cut(s) 391
PspPI GGNCC 1 cut(s) 4
PsuI RGATCY 1 cut(s) 195
PvuII CAGCTG 1 cut(s) 65
SatI GCNGC 2 cut(s) 233, 257
Sau3AI GATC 1 cut(s) 195
Sau96I GGNCC 1 cut(s) 4
SetI ASST 7 cut(s) 67, 123, 153, 220, 289, 339, 361
SfaNI GCATC 1 cut(s) 258
SgeI CNNG 9 cut(s) 103, 133, 160, 175, 205, 211, 236, 259, 329
Sse9I AATT 2 cut(s) 181, 238
SsiI CCGC 2 cut(s) 233, 257
TaiI ACGT 2 cut(s) 123, 339
TaqI TCGA 2 cut(s) 189, 242
TasI AATT 2 cut(s) 181, 238
TauI GCSGC 2 cut(s) 235, 259
TfiI GAWTC 1 cut(s) 109
XapI RAATTY 2 cut(s) 181, 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.