Rmu_co7996016.1_g000001

Stores iron in a soluble, non-toxic, readily available form. Important for iron homeostasis. Iron is taken up in the ferrous form and deposited as ferric hydroxides after oxidation

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7996016.1
Physical Location & Seq
Forward (+)
1 .. 481
481 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7996016.1_g000001.1.cds

Sequence Viewer

Length: 186 bp
atagctaatgaaaacaatgatgtgcatttagcggattacattgaaagtgaatacttgaatgaacaggtcgaatctataaggaaaatttctgaatatgtagctcagttgagaaggattggtccaggacatggtgtttggcactttgatcagatgctccttaatgacacagccggggtcgccgcatga

Protein Analysis

61

Amino Acids

6.91

Weight (kDa)

4.66

Isoelectric Point (pI)

41.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 128
AciI CCGC 2 cut(s) 32, 180
AcsI RAATTY 1 cut(s) 84
AfiI CCNNNNNNNGG 1 cut(s) 128
AgsI TTSAA 2 cut(s) 44, 58
AjnI CCWGG 1 cut(s) 121
AluBI AGCT 2 cut(s) 5, 101
AluI AGCT 2 cut(s) 5, 101
ApoI RAATTY 1 cut(s) 84
ArsI GACNNNNNNTTYG 2 cut(s) 117, 149
AspS9I GGNCC 1 cut(s) 119
AsuC2I CCSGG 1 cut(s) 172
AvaII GGWCC 1 cut(s) 119
BciT130I CCWGG 1 cut(s) 123
BclI TGATCA 1 cut(s) 145
BcnI CCSGG 1 cut(s) 172
BisI GCNGC 1 cut(s) 180
BlsI GCNGC 1 cut(s) 181
Bme1390I CCNGG 2 cut(s) 123, 172
Bme18I GGWCC 1 cut(s) 119
BmgT120I GGNCC 1 cut(s) 119
BmrFI CCNGG 2 cut(s) 123, 172
BmsI GCATC 1 cut(s) 141
BpuMI CCSGG 1 cut(s) 172
BsaJI CCNNGG 1 cut(s) 171
Bsc4I CCNNNNNNNGG 1 cut(s) 128
BseBI CCWGG 1 cut(s) 123
BseDI CCNNGG 1 cut(s) 171
BseLI CCNNNNNNNGG 1 cut(s) 128
BseMII CTCAG 1 cut(s) 116
BsiSI CCGG 1 cut(s) 171
BslI CCNNNNNNNGG 1 cut(s) 128
Bsp143I GATC 1 cut(s) 145
BspACI CCGC 2 cut(s) 32, 180
BspCNI CTCAG 1 cut(s) 115
BssECI CCNNGG 1 cut(s) 171
BssMI GATC 1 cut(s) 145
Bst2UI CCWGG 1 cut(s) 123
BstDEI CTNAG 1 cut(s) 102
BstKTI GATC 1 cut(s) 148
BstMBI GATC 1 cut(s) 145
BstMWI GCNNNNNNNGC 1 cut(s) 176
BstNI CCWGG 1 cut(s) 123
BstSCI CCNGG 2 cut(s) 121, 170
Cfr13I GGNCC 1 cut(s) 119
CviAII CATG 2 cut(s) 128, 183
CviJI RGCY 3 cut(s) 5, 101, 170
CviKI_1 RGCY 3 cut(s) 5, 101, 170
DdeI CTNAG 1 cut(s) 102
DpnI GATC 1 cut(s) 147
DpnII GATC 1 cut(s) 145
Eco47I GGWCC 1 cut(s) 119
EcoRII CCWGG 1 cut(s) 121
FaeI CATG 2 cut(s) 131, 186
FaiI YATR 4 cut(s) 77, 96, 129, 184
FatI CATG 2 cut(s) 127, 182
FbaI TGATCA 1 cut(s) 145
Fnu4HI GCNGC 1 cut(s) 180
Fsp4HI GCNGC 1 cut(s) 180
GluI GCNGC 1 cut(s) 180
HapII CCGG 1 cut(s) 171
Hin1II CATG 2 cut(s) 131, 186
HinfI GANTC 1 cut(s) 71
HpaII CCGG 1 cut(s) 171
Hpy188I TCNGA 2 cut(s) 91, 150
HpyAV CCTTC 1 cut(s) 105
HpyCH4V TGCA 1 cut(s) 25
HpyF10VI GCNNNNNNNGC 1 cut(s) 176
HpyF3I CTNAG 1 cut(s) 102
Hsp92II CATG 2 cut(s) 131, 186
Ksp22I TGATCA 1 cut(s) 145
Kzo9I GATC 1 cut(s) 145
LmnI GCTCC 1 cut(s) 159
LpnPI CCDG 3 cut(s) 50, 108, 135
LweI GCATC 1 cut(s) 141
MalI GATC 1 cut(s) 147
MboI GATC 1 cut(s) 145
MluCI AATT 1 cut(s) 84
MseI TTAA 1 cut(s) 159
MspI CCGG 1 cut(s) 171
MspR9I CCNGG 2 cut(s) 123, 172
MvaI CCWGG 1 cut(s) 123
MwoI GCNNNNNNNGC 1 cut(s) 176
NciI CCSGG 1 cut(s) 172
NdeII GATC 1 cut(s) 145
NlaIII CATG 2 cut(s) 131, 186
PfeI GAWTC 1 cut(s) 71
PflMI CCANNNNNTGG 1 cut(s) 128
PfoI TCCNGGA 1 cut(s) 121
PkrI GCNGC 1 cut(s) 181
Psp6I CCWGG 1 cut(s) 121
PspGI CCWGG 1 cut(s) 121
PspPI GGNCC 1 cut(s) 119
SaqAI TTAA 1 cut(s) 159
SatI GCNGC 1 cut(s) 180
Sau3AI GATC 1 cut(s) 145
Sau96I GGNCC 1 cut(s) 119
ScrFI CCNGG 2 cut(s) 123, 172
SetI ASST 3 cut(s) 7, 69, 103
SfaNI GCATC 1 cut(s) 141
SgeI CNNG 5 cut(s) 67, 77, 134, 135, 140
SinI GGWCC 1 cut(s) 119
Sse9I AATT 1 cut(s) 84
SsiI CCGC 2 cut(s) 32, 180
StyD4I CCNGG 2 cut(s) 121, 170
TaqI TCGA 1 cut(s) 69
TasI AATT 1 cut(s) 84
TauI GCSGC 1 cut(s) 182
TfiI GAWTC 1 cut(s) 71
Tru1I TTAA 1 cut(s) 159
Tru9I TTAA 1 cut(s) 159
TspDTI ATGAA 2 cut(s) 24, 75
Van91I CCANNNNNTGG 1 cut(s) 128
VpaK11BI GGWCC 1 cut(s) 119
XapI RAATTY 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.