Rmu_co8045116.1_g000001

DNA-binding domain in plant proteins such as APETALA2 and EREBPs

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8045116.1
Physical Location & Seq
Reverse (-)
2 .. 503
502 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8045116.1_g000001.1.cds

Sequence Viewer

Length: 502 bp
atgggcaagaggcccagagtggatgaaactgtcgttaaatgggagaagtacagtaaaaattttgattttgctaaagatggattggtgaatcggatgccacgtaggatgccaaccgtgggagctagaaagggtcgtatgagaggaaaaggagggcctgagaatttgaattgcagttatagaggtgttaggcagaggatttggggcaagtgggtttctgaaattcgagtaccaaatgctaatacacatggtttgacgtcgagaaaggttggtcgtctgtggcttggtacttttgatactgctgtagaagctgcacatgcttatgataaagctgcaaaggccatgtatggtcctgtggctcggcttaatttccccgaatctttggaaacatcaatgtcggatgagaccacagaatcgtgtgataatgcgtctgaatttgaggatggtgtgggtgaagagccaaagcaggaagatgaggtgtttgatgcaactgtaaaagagccaa

Protein Analysis

167

Amino Acids

18.82

Weight (kDa)

8.52

Isoelectric Point (pI)

42.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 257
AcsI RAATTY 4 cut(s) 58, 160, 219, 431
AcyI GRCGYC 1 cut(s) 254
AfaI GTAC 3 cut(s) 50, 228, 286
AfiI CCNNNNNNNGG 1 cut(s) 116
AgsI TTSAA 1 cut(s) 166
AluBI AGCT 3 cut(s) 122, 308, 329
AluI AGCT 3 cut(s) 122, 308, 329
Alw26I GTCTC 1 cut(s) 395
AoxI GGCC 3 cut(s) 11, 152, 336
ApeKI GCWGC 2 cut(s) 308, 329
ApoI RAATTY 4 cut(s) 58, 160, 219, 431
AspS9I GGNCC 3 cut(s) 12, 152, 347
AsuHPI GGTGA 2 cut(s) 97, 461
AvaII GGWCC 1 cut(s) 347
BaeI ACNNNNGTAYC 2 cut(s) 285, 318
BbvI GCAGC 2 cut(s) 295, 316
BccI CCATC 2 cut(s) 71, 434
BcoDI GTCTC 1 cut(s) 395
BfaI CTAG 1 cut(s) 123
BfmI CTRYAG 1 cut(s) 300
BisI GCNGC 2 cut(s) 309, 330
BlsI GCNGC 2 cut(s) 310, 331
Bme18I GGWCC 1 cut(s) 347
BmgT120I GGNCC 3 cut(s) 12, 152, 347
BmsI GCATC 3 cut(s) 84, 96, 472
BsaAI YACGTR 1 cut(s) 101
BsaHI GRCGYC 1 cut(s) 254
BsaI GGTCTC 1 cut(s) 395
BsaJI CCNNGG 1 cut(s) 114
Bsc4I CCNNNNNNNGG 1 cut(s) 116
BseDI CCNNGG 1 cut(s) 114
BseGI GGATG 5 cut(s) 28, 99, 111, 403, 445
BseLI CCNNNNNNNGG 1 cut(s) 116
BseMII CTCAG 1 cut(s) 147
BseXI GCAGC 2 cut(s) 295, 316
BsgI GTGCAG 1 cut(s) 294
BshFI GGCC 3 cut(s) 13, 154, 338
BslI CCNNNNNNNGG 1 cut(s) 116
BsmAI GTCTC 1 cut(s) 395
BsnI GGCC 3 cut(s) 13, 154, 338
Bso31I GGTCTC 1 cut(s) 395
BspANI GGCC 3 cut(s) 13, 154, 338
BspCNI CTCAG 1 cut(s) 148
BspQI GCTCTTC 1 cut(s) 447
BspTNI GGTCTC 1 cut(s) 395
BssECI CCNNGG 1 cut(s) 114
BssNI GRCGYC 1 cut(s) 254
Bst4CI ACNGT 4 cut(s) 31, 53, 115, 490
Bst6I CTCTTC 1 cut(s) 447
BstACI GRCGYC 1 cut(s) 254
BstBAI YACGTR 1 cut(s) 101
BstDEI CTNAG 1 cut(s) 156
BstDSI CCRYGG 1 cut(s) 114
BstF5I GGATG 5 cut(s) 28, 99, 111, 403, 445
BstMAI GTCTC 1 cut(s) 395
BstMWI GCNNNNNNNGC 3 cut(s) 305, 314, 335
BstNSI RCATGY 1 cut(s) 317
BstSFI CTRYAG 1 cut(s) 300
BstV1I GCAGC 2 cut(s) 295, 316
BsuRI GGCC 3 cut(s) 13, 154, 338
BtgI CCRYGG 1 cut(s) 114
BtsCI GGATG 5 cut(s) 28, 99, 111, 403, 445
Cfr13I GGNCC 3 cut(s) 12, 152, 347
CseI GACGC 1 cut(s) 414
Csp6I GTAC 3 cut(s) 49, 227, 285
CviAII CATG 3 cut(s) 245, 314, 340
CviQI GTAC 3 cut(s) 49, 227, 285
DdeI CTNAG 1 cut(s) 156
Eam1104I CTCTTC 1 cut(s) 447
EarI CTCTTC 1 cut(s) 447
Eco31I GGTCTC 1 cut(s) 395
Eco47I GGWCC 1 cut(s) 347
EcoO109I RGGNCCY 1 cut(s) 152
FaeI CATG 3 cut(s) 248, 317, 343
FaiI YATR 7 cut(s) 137, 177, 246, 315, 321, 341, 345
FatI CATG 3 cut(s) 244, 313, 339
Fnu4HI GCNGC 2 cut(s) 309, 330
FokI GGATG 5 cut(s) 35, 106, 118, 410, 452
Fsp4HI GCNGC 2 cut(s) 309, 330
FspBI CTAG 1 cut(s) 123
GluI GCNGC 2 cut(s) 309, 330
HaeIII GGCC 3 cut(s) 13, 154, 338
HgaI GACGC 1 cut(s) 414
Hin1I GRCGYC 1 cut(s) 254
Hin1II CATG 3 cut(s) 248, 317, 343
HinfI GANTC 3 cut(s) 88, 374, 410
HphI GGTGA 2 cut(s) 97, 461
Hpy188I TCNGA 4 cut(s) 93, 217, 397, 430
Hpy188III TCNNGA 1 cut(s) 258
Hpy99I CGWCG 1 cut(s) 259
HpyCH4III ACNGT 4 cut(s) 31, 53, 115, 490
HpyCH4IV ACGT 2 cut(s) 100, 254
HpyCH4V TGCA 4 cut(s) 171, 311, 332, 485
HpyF10VI GCNNNNNNNGC 3 cut(s) 305, 314, 335
HpyF3I CTNAG 1 cut(s) 156
HpySE526I ACGT 2 cut(s) 100, 254
Hsp92I GRCGYC 1 cut(s) 254
Hsp92II CATG 3 cut(s) 248, 317, 343
LguI GCTCTTC 1 cut(s) 447
LmnI GCTCC 1 cut(s) 119
LpnPI CCDG 4 cut(s) 28, 168, 363, 449
Lsp1109I GCAGC 2 cut(s) 295, 316
LweI GCATC 3 cut(s) 84, 96, 472
MaeI CTAG 1 cut(s) 123
MaeII ACGT 2 cut(s) 100, 254
MboII GAAGA 2 cut(s) 464, 479
MluCI AATT 6 cut(s) 58, 160, 166, 219, 364, 431
MmeI TCCRAC 1 cut(s) 375
MnlI CCTC 7 cut(s) 3, 134, 143, 173, 186, 430, 466
MseI TTAA 2 cut(s) 36, 363
MslI CAYNNNNRTG 1 cut(s) 318
MwoI GCNNNNNNNGC 3 cut(s) 305, 314, 335
NlaIII CATG 3 cut(s) 248, 317, 343
NmeAIII GCCGAG 1 cut(s) 337
NspI RCATGY 1 cut(s) 317
PciSI GCTCTTC 1 cut(s) 447
PcsI WCGNNNNNNNCGW 1 cut(s) 97
PfeI GAWTC 3 cut(s) 88, 374, 410
PkrI GCNGC 2 cut(s) 310, 331
Ppu21I YACGTR 1 cut(s) 101
PspPI GGNCC 3 cut(s) 12, 152, 347
RsaI GTAC 3 cut(s) 50, 228, 286
RsaNI GTAC 3 cut(s) 49, 227, 285
RseI CAYNNNNRTG 1 cut(s) 318
SapI GCTCTTC 1 cut(s) 447
SaqAI TTAA 2 cut(s) 36, 363
SatI GCNGC 2 cut(s) 309, 330
Sau96I GGNCC 3 cut(s) 12, 152, 347
SetI ASST 8 cut(s) 103, 124, 184, 257, 267, 310, 331, 477
SfaNI GCATC 3 cut(s) 84, 96, 472
SfcI CTRYAG 1 cut(s) 300
SinI GGWCC 1 cut(s) 347
SmiMI CAYNNNNRTG 1 cut(s) 318
Sse9I AATT 6 cut(s) 58, 160, 166, 219, 364, 431
SspMI CTAG 1 cut(s) 123
TaaI ACNGT 4 cut(s) 31, 53, 115, 490
TaiI ACGT 2 cut(s) 103, 257
TaqI TCGA 2 cut(s) 223, 257
TasI AATT 6 cut(s) 58, 160, 166, 219, 364, 431
TatI WGTACW 1 cut(s) 48
TfiI GAWTC 3 cut(s) 88, 374, 410
Tru1I TTAA 2 cut(s) 36, 363
Tru9I TTAA 2 cut(s) 36, 363
TseI GCWGC 2 cut(s) 308, 329
TspDTI ATGAA 1 cut(s) 39
VpaK11BI GGWCC 1 cut(s) 347
XapI RAATTY 4 cut(s) 58, 160, 219, 431
XceI RCATGY 1 cut(s) 317
XspI CTAG 1 cut(s) 123
ZraI GACGTC 1 cut(s) 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.