Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003094.1

Orthogroup ID

OG0003276

Physical Location & Seq

Genomic Coordinates Reverse (-)

72245 .. 72947

Gene Structure 703 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003094.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 588 bp

atgatgcctgagagttcagacgtggatagacaaatgggcaagaggcccagagttgatgatactttggttaaatgggagaagtacaatgaaaattctgattttgcaaaagatggatttgtgaatcgaatgccacgtaaaatgccaaccacaggggctagaaagggttgtatgagaggaaaaggggggcctgagaatttaaattctagttatagaggtgttagccaggggatttggggcaaatgggtttctgaaagtcgagtgccaagtactaatacacatggtctgacgttgaagaaggttgctcgtttatggcttggtacttttgatactgctgttgaagttgcacttgcttatgataaaactgcaaaggccatgtatggtcctgtattccccaagtctttggaaacatcaatctcggatgagaccacagaatctgtcaaagatgaattacaaatggaggacgagcttgttaataatgatgtagaagttgaagaactggctatcaacaatgtaagggagtctgtagatgaatggcattcagaacccaagtatgtgaaatgtgaatcggaaactgaggacgagtgttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001067 GO:0001101 GO:0003674 GO:0003676 GO:0003677 GO:0003700 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006355 GO:0006950 GO:0006970 GO:0008150 GO:0009266 GO:0009408 GO:0009414 GO:0009415 GO:0009628 GO:0009651 GO:0009889 GO:0009891 GO:0009893 GO:0009987 GO:0010035 GO:0010468 GO:0010556 GO:0010557 GO:0010604 GO:0010628 GO:0019219 GO:0019222 GO:0031323 GO:0031325 GO:0031326 GO:0031328 GO:0033554 GO:0034605 GO:0042221 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043565 GO:0044212 GO:0044424 GO:0044464 GO:0045893 GO:0045935 GO:0048518 GO:0048522 GO:0050789 GO:0050794 GO:0050896 GO:0051171 GO:0051173 GO:0051252 GO:0051254 GO:0051716 GO:0060255 GO:0065007 GO:0080090 GO:0097159 GO:0140110 GO:1901363 GO:1901700 GO:1902680 GO:1903506 GO:1903508 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AP2

Protein Analysis

195

Amino Acids

22.06

Weight (kDa)

4.93

Isoelectric Point (pI)

41.96

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003276)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g10690
malus_domestica	MD04G1165400.v1.1 MD12G1179500.v1.1
prunus_persica	Prupe.6G284400_v2.0.a1 Prupe.6G284400_v2.0.a1
pyrus_communis	pycom04g14750 pycom12g16930
rosa_chinensis	RchiOBHm_Chr3g0461691 RchiOBHm_Chr6g0312551
rosa_laevigata	RLG00000010317 RLG00000024905
rosa_multiflora	Rmu_co8045116.1_g000001 Rmu_co8349119.1_g000001 Rmu_sc0003094.1_g000012 Rmu_sc0008363.1_g000007 Rmu_sc0038320.1_g000002
rosa_roxburghii	Rroxscaffold_1G00048580 Rroxscaffold_2G00101990 Rroxscaffold_4G00310750 Rroxscaffold_6G00418040
rosa_rugosa	Rorug05G0531400 Rorug05G0531400 Rorug06G0396500
rosa_samantha	Rh3AG111200 Rh3BG114200 Rh3CG116400 Rh3DG116100 Rh4DG219100 Rh6AG513900 Rh6AG514000 Rh6BG525800 Rh6BG525900 Rh6CG530900 Rh6CG531000 Rh6DG516200 Rh6DG516300
rosa_wichuraiana	Rw3G009410

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	3 cut(s)	91, 193, 199
AfaI	GTAC	3 cut(s)	83, 268, 319
AfiI	CCNNNNNNNGG	1 cut(s)	149
AgsI	TTSAA	3 cut(s)	292, 338, 491
AjiI	CACGTC	1 cut(s)	22
AjnI	CCWGG	1 cut(s)	222
AluBI	AGCT	1 cut(s)	466
AluI	AGCT	1 cut(s)	466
Alw26I	GTCTC	1 cut(s)	416
AlwNI	CAGNNNCTG	1 cut(s)	434
AoxI	GGCC	3 cut(s)	44, 185, 369
ApoI	RAATTY	3 cut(s)	91, 193, 199
AspS9I	GGNCC	3 cut(s)	45, 185, 380
AvaII	GGWCC	1 cut(s)	380
BaeI	ACNNNNGTAYC	4 cut(s)	51, 84, 318, 351
BccI	CCATC	1 cut(s)	104
BciT130I	CCWGG	1 cut(s)	224
BcoDI	GTCTC	1 cut(s)	416
BfaI	CTAG	2 cut(s)	156, 204
BfmI	CTRYAG	1 cut(s)	522
BmcAI	AGTACT	1 cut(s)	268
Bme1390I	CCNGG	1 cut(s)	224
Bme18I	GGWCC	1 cut(s)	380
BmgBI	CACGTC	1 cut(s)	22
BmgT120I	GGNCC	3 cut(s)	45, 185, 380
BmiI	GGNNCC	1 cut(s)	186
BmrFI	CCNGG	1 cut(s)	224
BsaAI	YACGTR	1 cut(s)	134
BsaI	GGTCTC	1 cut(s)	416
BsaJI	CCNNGG	1 cut(s)	223
Bsc4I	CCNNNNNNNGG	1 cut(s)	149
Bse1I	ACTGG	1 cut(s)	501
BseBI	CCWGG	1 cut(s)	224
BseDI	CCNNGG	1 cut(s)	223
BseGI	GGATG	1 cut(s)	424
BseLI	CCNNNNNNNGG	1 cut(s)	149
BseMII	CTCAG	2 cut(s)	180, 564
BseNI	ACTGG	1 cut(s)	501
BshFI	GGCC	3 cut(s)	46, 187, 371
BslI	CCNNNNNNNGG	1 cut(s)	149
BsmAI	GTCTC	1 cut(s)	416
BsmI	GAATGC	2 cut(s)	132, 535
BsnI	GGCC	3 cut(s)	46, 187, 371
Bso31I	GGTCTC	1 cut(s)	416
BspANI	GGCC	3 cut(s)	46, 187, 371
BspCNI	CTCAG	2 cut(s)	181, 565
BspLI	GGNNCC	1 cut(s)	186
BspTNI	GGTCTC	1 cut(s)	416
BsrI	ACTGG	1 cut(s)	501
BssECI	CCNNGG	1 cut(s)	223
Bst2UI	CCWGG	1 cut(s)	224
BstBAI	YACGTR	1 cut(s)	134
BstDEI	CTNAG	3 cut(s)	9, 189, 573
BstF5I	GGATG	1 cut(s)	424
BstMAI	GTCTC	1 cut(s)	416
BstNI	CCWGG	1 cut(s)	224
BstSCI	CCNGG	1 cut(s)	222
BstSFI	CTRYAG	1 cut(s)	522
BstXI	CCANNNNNNTGG	1 cut(s)	400
BsuRI	GGCC	3 cut(s)	46, 187, 371
BtrI	CACGTC	1 cut(s)	22
BtsCI	GGATG	1 cut(s)	424
CaiI	CAGNNNCTG	1 cut(s)	434
Cfr13I	GGNCC	3 cut(s)	45, 185, 380
Csp6I	GTAC	3 cut(s)	82, 267, 318
CviAII	CATG	2 cut(s)	278, 373
CviJI	RGCY	8 cut(s)	46, 155, 187, 222, 313, 371, 466, 500
CviKI_1	RGCY	8 cut(s)	46, 155, 187, 222, 313, 371, 466, 500
CviQI	GTAC	3 cut(s)	82, 267, 318
DdeI	CTNAG	3 cut(s)	9, 189, 573
DraI	TTTAAA	1 cut(s)	198
Eco31I	GGTCTC	1 cut(s)	416
Eco47I	GGWCC	1 cut(s)	380
EcoO109I	RGGNCCY	1 cut(s)	185
EcoRII	CCWGG	1 cut(s)	222
FaeI	CATG	2 cut(s)	281, 376
FaiI	YATR	8 cut(s)	170, 210, 279, 310, 354, 374, 378, 552
FalI	AAGNNNNNCTT	2 cut(s)	330, 362
FatI	CATG	2 cut(s)	277, 372
FokI	GGATG	1 cut(s)	431
FspBI	CTAG	2 cut(s)	156, 204
HaeIII	GGCC	3 cut(s)	46, 187, 371
Hin1II	CATG	2 cut(s)	281, 376
HinfI	GANTC	4 cut(s)	121, 431, 518, 563
Hpy188I	TCNGA	7 cut(s)	19, 97, 250, 285, 418, 541, 568
HpyAV	CCTTC	1 cut(s)	289
HpyCH4IV	ACGT	3 cut(s)	21, 133, 287
HpyCH4V	TGCA	3 cut(s)	104, 344, 365
HpyF3I	CTNAG	3 cut(s)	9, 189, 573
HpySE526I	ACGT	3 cut(s)	21, 133, 287
Hsp92II	CATG	2 cut(s)	281, 376
LpnPI	CCDG	8 cut(s)	21, 61, 135, 201, 209, 236, 396, 482
MaeI	CTAG	2 cut(s)	156, 204
MaeII	ACGT	3 cut(s)	21, 133, 287
MboII	GAAGA	2 cut(s)	304, 503
MluCI	AATT	4 cut(s)	91, 193, 199, 446
MlyI	GAGTC	1 cut(s)	527
MnlI	CCTC	5 cut(s)	36, 167, 206, 451, 568
MseI	TTAA	4 cut(s)	69, 197, 471, 586
MspR9I	CCNGG	1 cut(s)	224
Mva1269I	GAATGC	2 cut(s)	132, 535
MvaI	CCWGG	1 cut(s)	224
NlaIII	CATG	2 cut(s)	281, 376
NlaIV	GGNNCC	1 cut(s)	186
PcsI	WCGNNNNNNNCGW	1 cut(s)	130
PctI	GAATGC	2 cut(s)	132, 535
PfeI	GAWTC	3 cut(s)	121, 431, 563
PleI	GAGTC	1 cut(s)	526
PpsI	GAGTC	1 cut(s)	526
Ppu21I	YACGTR	1 cut(s)	134
Psp6I	CCWGG	1 cut(s)	222
PspGI	CCWGG	1 cut(s)	222
PspN4I	GGNNCC	1 cut(s)	186
PspPI	GGNCC	3 cut(s)	45, 185, 380
PstNI	CAGNNNCTG	1 cut(s)	434
RsaI	GTAC	3 cut(s)	83, 268, 319
RsaNI	GTAC	3 cut(s)	82, 267, 318
SaqAI	TTAA	4 cut(s)	69, 197, 471, 586
Sau96I	GGNCC	3 cut(s)	45, 185, 380
ScaI	AGTACT	1 cut(s)	268
SchI	GAGTC	1 cut(s)	527
ScrFI	CCNGG	1 cut(s)	224
SetI	ASST	6 cut(s)	24, 136, 217, 290, 300, 468
SfcI	CTRYAG	1 cut(s)	522
SinI	GGWCC	1 cut(s)	380
SmiI	ATTTAAAT	1 cut(s)	198
Sse9I	AATT	4 cut(s)	91, 193, 199, 446
SspMI	CTAG	2 cut(s)	156, 204
StyD4I	CCNGG	1 cut(s)	222
SwaI	ATTTAAAT	1 cut(s)	198
TaiI	ACGT	3 cut(s)	24, 136, 290
TaqI	TCGA	2 cut(s)	124, 256
TasI	AATT	4 cut(s)	91, 193, 199, 446
TatI	WGTACW	2 cut(s)	81, 266
TfiI	GAWTC	3 cut(s)	121, 431, 563
Tru1I	TTAA	4 cut(s)	69, 197, 471, 586
Tru9I	TTAA	4 cut(s)	69, 197, 471, 586
TspDTI	ATGAA	3 cut(s)	102, 459, 543
VpaK11BI	GGWCC	1 cut(s)	380
XapI	RAATTY	3 cut(s)	91, 193, 199
XspI	CTAG	2 cut(s)	156, 204
ZrmI	AGTACT	1 cut(s)	268

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.