Rroxscaffold_1G00048580

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
68640700 .. 68648707
8008 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00048580.1

Sequence Viewer

Length: 273 bp
ATGTCGCTACCGATTTTTCATGAAATTGAAGCAAAAACCATGAACGAGATTCAAAATCTAACCAAACTTATAGATTGTTTCTTTGGAAATCAAGACAGAGAGTATGTTGACTTGATTTCTTGGACGGATGAGATCATAAGCTTGAGAAAAAGTAAGGAAAGAGTCCAAGATCGGCAGAAGCCTTCAAAAGATACCGAACTGCAGAAGCAGATTGACGAGAAACTTGGCTTCTTGCATAGTTGGTCTCTTGATGAAACATATGGCACTAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.65

Weight (kDa)

4.94

Isoelectric Point (pI)

34.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 29, 53, 186
AluBI AGCT 2 cut(s) 141, 270
AluI AGCT 2 cut(s) 141, 270
Alw26I GTCTC 1 cut(s) 249
BcoDI GTCTC 1 cut(s) 249
BfaI CTAG 1 cut(s) 267
BfmI CTRYAG 1 cut(s) 200
BpuEI CTTGAG 1 cut(s) 163
BsaI GGTCTC 1 cut(s) 249
BseGI GGATG 1 cut(s) 133
BsmAI GTCTC 1 cut(s) 249
Bso31I GGTCTC 1 cut(s) 249
Bsp143I GATC 2 cut(s) 132, 169
BspHI TCATGA 1 cut(s) 19
BspMAI CTGCAG 1 cut(s) 204
BspTNI GGTCTC 1 cut(s) 249
BssMI GATC 2 cut(s) 132, 169
BstF5I GGATG 1 cut(s) 133
BstKTI GATC 2 cut(s) 135, 172
BstMAI GTCTC 1 cut(s) 249
BstMBI GATC 2 cut(s) 132, 169
BstSFI CTRYAG 1 cut(s) 200
BtsCI GGATG 1 cut(s) 133
CciI TCATGA 1 cut(s) 19
CviAII CATG 2 cut(s) 20, 40
CviJI RGCY 4 cut(s) 141, 181, 228, 270
CviKI_1 RGCY 4 cut(s) 141, 181, 228, 270
DpnI GATC 2 cut(s) 134, 171
DpnII GATC 2 cut(s) 132, 169
Eco31I GGTCTC 1 cut(s) 249
FaeI CATG 2 cut(s) 23, 43
FaiI YATR 8 cut(s) 21, 41, 71, 105, 137, 237, 259, 261
FatI CATG 2 cut(s) 19, 39
FauNDI CATATG 1 cut(s) 259
FokI GGATG 1 cut(s) 140
FspBI CTAG 1 cut(s) 267
Hin1II CATG 2 cut(s) 23, 43
HincII GTYRAC 1 cut(s) 109
HindII GTYRAC 1 cut(s) 109
HindIII AAGCTT 1 cut(s) 139
HinfI GANTC 2 cut(s) 49, 162
Hpy166II GTNNAC 1 cut(s) 109
Hpy188III TCNNGA 3 cut(s) 20, 92, 248
Hpy8I GTNNAC 1 cut(s) 109
HpyAV CCTTC 1 cut(s) 192
HpyCH4V TGCA 2 cut(s) 202, 235
Hsp92II CATG 2 cut(s) 23, 43
Kzo9I GATC 2 cut(s) 132, 169
MaeI CTAG 1 cut(s) 267
MalI GATC 2 cut(s) 134, 171
MboI GATC 2 cut(s) 132, 169
MluCI AATT 1 cut(s) 24
MlyI GAGTC 1 cut(s) 171
NdeI CATATG 1 cut(s) 259
NdeII GATC 2 cut(s) 132, 169
NlaIII CATG 2 cut(s) 23, 43
PagI TCATGA 1 cut(s) 19
PfeI GAWTC 1 cut(s) 49
PleI GAGTC 1 cut(s) 170
PpsI GAGTC 1 cut(s) 170
PstI CTGCAG 1 cut(s) 204
Sau3AI GATC 2 cut(s) 132, 169
SchI GAGTC 1 cut(s) 171
SetI ASST 2 cut(s) 143, 272
SfcI CTRYAG 1 cut(s) 200
SmlI CTYRAG 1 cut(s) 142
SmoI CTYRAG 1 cut(s) 142
Sse9I AATT 1 cut(s) 24
SspMI CTAG 1 cut(s) 267
TasI AATT 1 cut(s) 24
TfiI GAWTC 1 cut(s) 49
TspDTI ATGAA 4 cut(s) 8, 36, 56, 267
TspGWI ACGGA 1 cut(s) 140
XspI CTAG 1 cut(s) 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.