Rmu_sc0008363.1_g000007

DNA-binding domain in plant proteins such as APETALA2 and EREBPs

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008363.1
Physical Location & Seq
Reverse (-)
75662 .. 76147
486 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008363.1_g000007.1.cds

Sequence Viewer

Length: 486 bp
atgcgtctgaatttgaggagtgtggatgaagagccaaagcaggaagatgaggtgtttgatgcaactgtaagagagcctgtaaatgaatggcattgggaagctaatagtgtcaaaggtgaattacaaatggaggacgagcttgttaataatgatgtagaagttgaagaactggctatcaacaatgtaagggagtctgtagatgtatggcattcagaacccaagtatgtgaaatgtgaatcggaaactgaggacgagtttgttaaagatatggaagttgaagcactcgctatgaacaatgtaagggagtctgaagatgtacggccttgggaacccaagtatgtggaatgtgaattggaaaatgaggaccagcttgttacaaatgatgttgaagttgaagcagtcactacaaacaatgtaagggagtacgaaaatgtatggcattgggaacctaagtatgtaaaatgcgatttggaaactcaggactag

Protein Analysis

161

Amino Acids

19.15

Weight (kDa)

4.15

Isoelectric Point (pI)

46.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 10
AcuI CTGAAG 1 cut(s) 330
AfaI GTAC 2 cut(s) 318, 425
AgsI TTSAA 4 cut(s) 164, 278, 389, 395
AluBI AGCT 3 cut(s) 101, 139, 370
AluI AGCT 3 cut(s) 101, 139, 370
AoxI GGCC 1 cut(s) 320
ApoI RAATTY 1 cut(s) 10
AspS9I GGNCC 1 cut(s) 364
AsuHPI GGTGA 1 cut(s) 128
AvaII GGWCC 1 cut(s) 364
BceAI ACGGC 1 cut(s) 335
BfaI CTAG 1 cut(s) 484
BfmI CTRYAG 1 cut(s) 195
Bme18I GGWCC 1 cut(s) 364
BmgT120I GGNCC 1 cut(s) 364
BmiI GGNNCC 2 cut(s) 330, 447
BmsI GCATC 1 cut(s) 49
BsaJI CCNNGG 1 cut(s) 323
Bse1I ACTGG 1 cut(s) 174
BseDI CCNNGG 1 cut(s) 323
BseGI GGATG 1 cut(s) 31
BseMII CTCAG 1 cut(s) 237
BseNI ACTGG 1 cut(s) 174
BseRI GAGGAG 1 cut(s) 31
BshFI GGCC 1 cut(s) 322
BsmI GAATGC 1 cut(s) 208
BsnI GGCC 1 cut(s) 322
BspANI GGCC 1 cut(s) 322
BspCNI CTCAG 1 cut(s) 238
BspLI GGNNCC 2 cut(s) 330, 447
BspQI GCTCTTC 1 cut(s) 24
BsrI ACTGG 1 cut(s) 174
BssECI CCNNGG 1 cut(s) 323
BssT1I CCWWGG 1 cut(s) 323
Bst4CI ACNGT 1 cut(s) 67
Bst6I CTCTTC 1 cut(s) 24
BstDEI CTNAG 3 cut(s) 246, 450, 477
BstF5I GGATG 1 cut(s) 31
BstSFI CTRYAG 1 cut(s) 195
BstXI CCANNNNNNTGG 1 cut(s) 340
BsuRI GGCC 1 cut(s) 322
BtsCI GGATG 1 cut(s) 31
Cfr13I GGNCC 1 cut(s) 364
Csp6I GTAC 2 cut(s) 317, 424
CviJI RGCY 7 cut(s) 34, 76, 101, 139, 173, 322, 370
CviKI_1 RGCY 7 cut(s) 34, 76, 101, 139, 173, 322, 370
CviQI GTAC 2 cut(s) 317, 424
DdeI CTNAG 3 cut(s) 246, 450, 477
Eam1104I CTCTTC 1 cut(s) 24
EarI CTCTTC 1 cut(s) 24
Eco130I CCWWGG 1 cut(s) 323
Eco47I GGWCC 1 cut(s) 364
Eco57I CTGAAG 1 cut(s) 330
EcoT14I CCWWGG 1 cut(s) 323
ErhI CCWWGG 1 cut(s) 323
FaiI YATR 7 cut(s) 205, 225, 269, 290, 339, 436, 456
FokI GGATG 1 cut(s) 38
FspBI CTAG 1 cut(s) 484
HaeIII GGCC 1 cut(s) 322
HinfI GANTC 3 cut(s) 191, 236, 305
HphI GGTGA 1 cut(s) 128
Hpy188I TCNGA 4 cut(s) 9, 214, 241, 310
Hpy188III TCNNGA 1 cut(s) 479
HpyCH4III ACNGT 1 cut(s) 67
HpyCH4V TGCA 1 cut(s) 62
HpyF3I CTNAG 3 cut(s) 246, 450, 477
LguI GCTCTTC 1 cut(s) 24
LpnPI CCDG 5 cut(s) 26, 90, 155, 380, 464
LweI GCATC 1 cut(s) 49
MaeI CTAG 1 cut(s) 484
MaeIII GTNAC 2 cut(s) 373, 400
MboII GAAGA 4 cut(s) 41, 56, 176, 323
MluCI AATT 3 cut(s) 10, 119, 350
MlyI GAGTC 2 cut(s) 200, 314
MnlI CCTC 5 cut(s) 9, 43, 124, 241, 355
MseI TTAA 2 cut(s) 144, 261
Mva1269I GAATGC 1 cut(s) 208
NlaIV GGNNCC 2 cut(s) 330, 447
NmuCI GTSAC 1 cut(s) 400
PciSI GCTCTTC 1 cut(s) 24
PctI GAATGC 1 cut(s) 208
PfeI GAWTC 1 cut(s) 236
PleI GAGTC 2 cut(s) 199, 313
PpsI GAGTC 2 cut(s) 199, 313
PspN4I GGNNCC 2 cut(s) 330, 447
PspPI GGNCC 1 cut(s) 364
RsaI GTAC 2 cut(s) 318, 425
RsaNI GTAC 2 cut(s) 317, 424
SapI GCTCTTC 1 cut(s) 24
SaqAI TTAA 2 cut(s) 144, 261
Sau96I GGNCC 1 cut(s) 364
SchI GAGTC 2 cut(s) 200, 314
SetI ASST 6 cut(s) 54, 103, 118, 141, 372, 451
SfaNI GCATC 1 cut(s) 49
SfcI CTRYAG 1 cut(s) 195
SinI GGWCC 1 cut(s) 364
Sse9I AATT 3 cut(s) 10, 119, 350
SspMI CTAG 1 cut(s) 484
StyI CCWWGG 1 cut(s) 323
TaaI ACNGT 1 cut(s) 67
TasI AATT 3 cut(s) 10, 119, 350
TfiI GAWTC 1 cut(s) 236
Tru1I TTAA 2 cut(s) 144, 261
Tru9I TTAA 2 cut(s) 144, 261
TseFI GTSAC 1 cut(s) 400
Tsp45I GTSAC 1 cut(s) 400
TspDTI ATGAA 3 cut(s) 42, 99, 305
VpaK11BI GGWCC 1 cut(s) 364
XapI RAATTY 1 cut(s) 10
XspI CTAG 1 cut(s) 484
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.