Rmu_co8186410.1_g000001

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8186410.1
Physical Location & Seq
Forward (+)
1 .. 428
428 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8186410.1_g000001.1.cds

Sequence Viewer

Length: 235 bp
tgtgtcgttgcaaaagggtggaagtgtggtttggtctatagatactggtggcaaaacagttactgcaacggagttgcgggactcgggaaatttggttctgcttggggatgacaatggagtagtttggcagggttctagtcatccaactgatactctattatggaaccaggagtctcaggaaggaatgaaacttcaaagcgaaccaatctccaacaatgtgacctacaggtcttag

Protein Analysis

77

Amino Acids

8.29

Weight (kDa)

4.56

Isoelectric Point (pI)

45.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 227
AciI CCGC 1 cut(s) 77
AcsI RAATTY 1 cut(s) 89
AgsI TTSAA 1 cut(s) 195
AjnI CCWGG 1 cut(s) 166
AjuI GAANNNNNNNTTGG 2 cut(s) 14, 46
AloI GAACNNNNNNTCC 2 cut(s) 79, 111
Alw26I GTCTC 1 cut(s) 178
AlwNI CAGNNNCTG 1 cut(s) 63
Ama87I CYCGRG 1 cut(s) 83
ApoI RAATTY 1 cut(s) 89
AvaI CYCGRG 1 cut(s) 83
BciT130I CCWGG 1 cut(s) 168
BcoDI GTCTC 1 cut(s) 178
BfaI CTAG 1 cut(s) 136
BfmI CTRYAG 2 cut(s) 37, 224
Bme1390I CCNGG 1 cut(s) 168
BmeT110I CYCGRG 1 cut(s) 83
BmiI GGNNCC 1 cut(s) 165
BmrFI CCNGG 1 cut(s) 168
Bse1I ACTGG 1 cut(s) 50
BseBI CCWGG 1 cut(s) 168
BseGI GGATG 2 cut(s) 113, 140
BseMII CTCAG 1 cut(s) 189
BseNI ACTGG 1 cut(s) 50
BsiHKCI CYCGRG 1 cut(s) 83
BslFI GGGAC 1 cut(s) 93
BsmAI GTCTC 1 cut(s) 178
BsmFI GGGAC 1 cut(s) 93
BsoBI CYCGRG 1 cut(s) 83
BspACI CCGC 1 cut(s) 77
BspCNI CTCAG 1 cut(s) 188
BspLI GGNNCC 1 cut(s) 165
BsrI ACTGG 1 cut(s) 50
Bst2UI CCWGG 1 cut(s) 168
Bst4CI ACNGT 1 cut(s) 59
BstDEI CTNAG 2 cut(s) 175, 232
BstF5I GGATG 2 cut(s) 113, 140
BstMAI GTCTC 1 cut(s) 178
BstNI CCWGG 1 cut(s) 168
BstSCI CCNGG 1 cut(s) 166
BstSFI CTRYAG 2 cut(s) 37, 224
BtsCI GGATG 2 cut(s) 113, 140
CaiI CAGNNNCTG 1 cut(s) 63
DdeI CTNAG 2 cut(s) 175, 232
DrdI GACNNNNNNGTC 1 cut(s) 227
DseDI GACNNNNNNGTC 1 cut(s) 227
Eco88I CYCGRG 1 cut(s) 83
EcoRII CCWGG 1 cut(s) 166
FaiI YATR 2 cut(s) 39, 161
FaqI GGGAC 1 cut(s) 93
FauI CCCGC 1 cut(s) 70
FokI GGATG 2 cut(s) 120, 127
FspBI CTAG 1 cut(s) 136
HinfI GANTC 2 cut(s) 81, 171
Hpy188III TCNNGA 2 cut(s) 85, 177
HpyAV CCTTC 1 cut(s) 174
HpyCH4III ACNGT 1 cut(s) 59
HpyCH4V TGCA 2 cut(s) 11, 66
HpyF3I CTNAG 2 cut(s) 175, 232
LpnPI CCDG 6 cut(s) 31, 114, 153, 162, 180, 212
MaeI CTAG 1 cut(s) 136
MaeIII GTNAC 2 cut(s) 59, 218
MluCI AATT 1 cut(s) 89
MlyI GAGTC 2 cut(s) 75, 180
MmeI TCCRAC 2 cut(s) 168, 235
MspR9I CCNGG 1 cut(s) 168
MvaI CCWGG 1 cut(s) 168
NlaIV GGNNCC 1 cut(s) 165
NmuCI GTSAC 1 cut(s) 218
PleI GAGTC 2 cut(s) 75, 179
PpsI GAGTC 2 cut(s) 75, 179
Psp6I CCWGG 1 cut(s) 166
PspGI CCWGG 1 cut(s) 166
PspN4I GGNNCC 1 cut(s) 165
PstNI CAGNNNCTG 1 cut(s) 63
SchI GAGTC 2 cut(s) 75, 180
ScrFI CCNGG 1 cut(s) 168
SetI ASST 2 cut(s) 225, 231
SfcI CTRYAG 2 cut(s) 37, 224
Sse9I AATT 1 cut(s) 89
SsiI CCGC 1 cut(s) 77
SspMI CTAG 1 cut(s) 136
StyD4I CCNGG 1 cut(s) 166
TaaI ACNGT 1 cut(s) 59
TasI AATT 1 cut(s) 89
TseFI GTSAC 1 cut(s) 218
Tsp45I GTSAC 1 cut(s) 218
TspDTI ATGAA 1 cut(s) 201
TspGWI ACGGA 1 cut(s) 84
XapI RAATTY 1 cut(s) 89
XspI CTAG 1 cut(s) 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.