Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8284673.1

Orthogroup ID

OG0002717

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 567

Gene Structure 567 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8284673.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 365 bp

gagacatgtatgctgatataagcactgaaaatgccttgctccagggatccagaagactgagtaaaggtgtagagtatttagttgaagcatcagcagcagaagctgaggcaatcagcgctactttggctgctgccaaggcacgacaagttaatggagaagtagagttacctgatagagatcgtggctcagaggctaccccaagcgggaagcaaatatctaccttgatcaagcctgaaaatgctgggtcaaataatattccatcagctggagtgcgagtgcatcatagagctattagttgttgtagctgcagagactgggggagctttgggcggcatgttgaggcagcttttaatagatcagtttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005886 GO:0016020 GO:0044424 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Kelch_2 Kelch_4 Metallophos

Protein Analysis

120

Amino Acids

12.76

Weight (kDa)

6.34

Isoelectric Point (pI)

40.7

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002717)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G08420 AT1G08420 AT2G27210 AT2G27210
fragaria_vesca	FvH4_3g26300
malus_domestica	MD03G1156600.v1.1 MD03G1157300.v1.1 MD11G1174100.v1.1
prunus_persica	Prupe.6G145800_v2.0.a1 Prupe.6G145800_v2.0.a1 Prupe.6G145800_v2.0.a1 Prupe.6G145800_v2.0.a1 Prupe.6G145800_v2.0.a1
pyrus_communis	pycom03g11040 pycom11g14860
rosa_chinensis	RchiOBHm_Chr5g0048611 RchiOBHm_Chr7g0219991 RchiOBHm_Chr7g0220001
rosa_laevigata	RLG00000034543
rosa_multiflora	Rmu_co8183230.1_g000001 Rmu_co8284673.1_g000001 Rmu_sc0005838.1_g000012 Rmu_sc0005838.1_g000013 Rmu_sc0007553.1_g000001 Rmu_sc0008151.1_g000001
rosa_roxburghii	Rroxscaffold_1G00033170 Rroxscaffold_3G00239830
rosa_rugosa	Rorug05G0240500 Rorug07G0188300
rosa_samantha	Rh5AG319700 Rh5CG355900 Rh7AG332100 Rh7CG349500 Rh7CG349600 Rh7DG327700 Rh7DG327800
rosa_wichuraiana	Rw0G021290 Rw5G029900 Rw7G027970

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	265
AciI	CCGC	2 cut(s)	203, 330
AclWI	GGATC	2 cut(s)	41, 54
AfeI	AGCGCT	1 cut(s)	117
AfiI	CCNNNNNNNGG	2 cut(s)	203, 265
AflIII	ACRYGT	1 cut(s)	5
AgsI	TTSAA	1 cut(s)	85
AjnI	CCWGG	1 cut(s)	41
AluBI	AGCT	6 cut(s)	103, 265, 289, 305, 323, 346
AluI	AGCT	6 cut(s)	103, 265, 289, 305, 323, 346
Alw26I	GTCTC	1 cut(s)	305
AlwI	GGATC	2 cut(s)	41, 54
AlwNI	CAGNNNCTG	2 cut(s)	103, 314
Aor51HI	AGCGCT	1 cut(s)	117
ApeKI	GCWGC	5 cut(s)	94, 127, 130, 305, 343
AspLEI	GCGC	1 cut(s)	118
BamHI	GGATCC	1 cut(s)	46
BarI	GAAGNNNNNNTAC	2 cut(s)	149, 181
BbsI	GAAGAC	1 cut(s)	60
BbvCI	CCTCAGC	1 cut(s)	104
BbvI	GCAGC	5 cut(s)	106, 114, 117, 292, 355
BccI	CCATC	1 cut(s)	267
BciT130I	CCWGG	1 cut(s)	43
BclI	TGATCA	1 cut(s)	224
BcoDI	GTCTC	1 cut(s)	305
BfmI	CTRYAG	1 cut(s)	306
BfoI	RGCGCY	1 cut(s)	119
BisI	GCNGC	6 cut(s)	95, 128, 131, 306, 331, 344
BlsI	GCNGC	6 cut(s)	96, 129, 132, 307, 332, 345
Bme1390I	CCNGG	1 cut(s)	43
BmiI	GGNNCC	1 cut(s)	48
BmrFI	CCNGG	1 cut(s)	43
BmrI	ACTGGG	1 cut(s)	324
BmsI	GCATC	2 cut(s)	97, 288
BmuI	ACTGGG	1 cut(s)	324
BpiI	GAAGAC	1 cut(s)	60
BpmI	CTGGAG	2 cut(s)	25, 287
Bpu10I	CCTNAGC	1 cut(s)	104
BsaBI	GATNNNNATC	1 cut(s)	176
BsaJI	CCNNGG	2 cut(s)	42, 134
BsaXI	ACNNNNNCTCC	2 cut(s)	260, 290
Bsc4I	CCNNNNNNNGG	2 cut(s)	203, 265
Bse1I	ACTGG	1 cut(s)	319
Bse8I	GATNNNNATC	1 cut(s)	176
BseBI	CCWGG	1 cut(s)	43
BseDI	CCNNGG	2 cut(s)	42, 134
BseJI	GATNNNNATC	1 cut(s)	176
BseLI	CCNNNNNNNGG	2 cut(s)	203, 265
BseMII	CTCAG	3 cut(s)	49, 95, 200
BseNI	ACTGG	1 cut(s)	319
BseXI	GCAGC	5 cut(s)	106, 114, 117, 292, 355
BseYI	CCCAGC	1 cut(s)	241
BslI	CCNNNNNNNGG	2 cut(s)	203, 265
BsmAI	GTCTC	1 cut(s)	305
Bsp143I	GATC	4 cut(s)	46, 177, 224, 355
BspACI	CCGC	2 cut(s)	203, 330
BspCNI	CTCAG	3 cut(s)	50, 96, 199
BspLI	GGNNCC	1 cut(s)	48
BspMAI	CTGCAG	1 cut(s)	310
BspPI	GGATC	2 cut(s)	41, 54
BsrI	ACTGG	1 cut(s)	319
BssECI	CCNNGG	2 cut(s)	42, 134
BssMI	GATC	4 cut(s)	46, 177, 224, 355
BssT1I	CCWWGG	1 cut(s)	134
Bst2UI	CCWGG	1 cut(s)	43
BstDEI	CTNAG	3 cut(s)	58, 104, 186
BstH2I	RGCGCY	1 cut(s)	119
BstHHI	GCGC	1 cut(s)	118
BstKTI	GATC	4 cut(s)	49, 180, 227, 358
BstMAI	GTCTC	1 cut(s)	305
BstMBI	GATC	4 cut(s)	46, 177, 224, 355
BstMWI	GCNNNNNNNGC	5 cut(s)	94, 100, 115, 124, 136
BstNI	CCWGG	1 cut(s)	43
BstNSI	RCATGY	2 cut(s)	9, 337
BstSCI	CCNGG	1 cut(s)	41
BstSFI	CTRYAG	1 cut(s)	306
BstV1I	GCAGC	5 cut(s)	106, 114, 117, 292, 355
BstV2I	GAAGAC	1 cut(s)	60
BstX2I	RGATCY	1 cut(s)	46
BstYI	RGATCY	1 cut(s)	46
BtsIMutI	CAGTG	1 cut(s)	23
CaiI	CAGNNNCTG	2 cut(s)	103, 314
CfoI	GCGC	1 cut(s)	118
CviAII	CATG	2 cut(s)	6, 334
DdeI	CTNAG	3 cut(s)	58, 104, 186
DpnI	GATC	4 cut(s)	48, 179, 226, 357
DpnII	GATC	4 cut(s)	46, 177, 224, 355
Eco130I	CCWWGG	1 cut(s)	134
Eco47III	AGCGCT	1 cut(s)	117
EcoRII	CCWGG	1 cut(s)	41
EcoT14I	CCWWGG	1 cut(s)	134
ErhI	CCWWGG	1 cut(s)	134
FaeI	CATG	2 cut(s)	9, 337
FaiI	YATR	5 cut(s)	7, 11, 19, 284, 335
FatI	CATG	2 cut(s)	5, 333
FauI	CCCGC	1 cut(s)	196
FbaI	TGATCA	1 cut(s)	224
Fnu4HI	GCNGC	6 cut(s)	95, 128, 131, 306, 331, 344
Fsp4HI	GCNGC	6 cut(s)	95, 128, 131, 306, 331, 344
GlaI	GCGC	1 cut(s)	117
GluI	GCNGC	6 cut(s)	95, 128, 131, 306, 331, 344
GsaI	CCCAGC	1 cut(s)	245
GsuI	CTGGAG	2 cut(s)	25, 287
HaeII	RGCGCY	1 cut(s)	119
HhaI	GCGC	1 cut(s)	118
Hin1II	CATG	2 cut(s)	9, 337
Hin6I	GCGC	1 cut(s)	116
HinP1I	GCGC	1 cut(s)	116
Hpy188I	TCNGA	1 cut(s)	189
Hpy188III	TCNNGA	1 cut(s)	50
HpyCH4V	TGCA	2 cut(s)	279, 308
HpyF10VI	GCNNNNNNNGC	5 cut(s)	94, 100, 115, 124, 136
HpyF3I	CTNAG	3 cut(s)	58, 104, 186
Hsp92II	CATG	2 cut(s)	9, 337
HspAI	GCGC	1 cut(s)	116
Ksp22I	TGATCA	1 cut(s)	224
Kzo9I	GATC	4 cut(s)	46, 177, 224, 355
LmnI	GCTCC	2 cut(s)	44, 320
LpnPI	CCDG	8 cut(s)	28, 55, 63, 182, 227, 245, 251, 300
Lsp1109I	GCAGC	5 cut(s)	106, 114, 117, 292, 355
LweI	GCATC	2 cut(s)	97, 288
MaeIII	GTNAC	1 cut(s)	164
MalI	GATC	4 cut(s)	48, 179, 226, 357
MboI	GATC	4 cut(s)	46, 177, 224, 355
MboII	GAAGA	1 cut(s)	65
MflI	RGATCY	1 cut(s)	46
MnlI	CCTC	3 cut(s)	99, 183, 333
MseI	TTAA	2 cut(s)	149, 350
MspA1I	CMGCKG	1 cut(s)	265
MspR9I	CCNGG	1 cut(s)	43
MvaI	CCWGG	1 cut(s)	43
MwoI	GCNNNNNNNGC	5 cut(s)	94, 100, 115, 124, 136
NdeII	GATC	4 cut(s)	46, 177, 224, 355
NlaIII	CATG	2 cut(s)	9, 337
NlaIV	GGNNCC	1 cut(s)	48
NspI	RCATGY	2 cut(s)	9, 337
PciI	ACATGT	1 cut(s)	5
PflMI	CCANNNNNTGG	1 cut(s)	265
PkrI	GCNGC	6 cut(s)	96, 129, 132, 307, 332, 345
PscI	ACATGT	1 cut(s)	5
Psp6I	CCWGG	1 cut(s)	41
PspFI	CCCAGC	1 cut(s)	241
PspGI	CCWGG	1 cut(s)	41
PspN4I	GGNNCC	1 cut(s)	48
PstI	CTGCAG	1 cut(s)	310
PstNI	CAGNNNCTG	2 cut(s)	103, 314
PsuI	RGATCY	1 cut(s)	46
PvuII	CAGCTG	1 cut(s)	265
SaqAI	TTAA	2 cut(s)	149, 350
SatI	GCNGC	6 cut(s)	95, 128, 131, 306, 331, 344
Sau3AI	GATC	4 cut(s)	46, 177, 224, 355
ScrFI	CCNGG	1 cut(s)	43
SetI	ASST	9 cut(s)	69, 105, 171, 223, 267, 291, 307, 325, 348
SfaNI	GCATC	2 cut(s)	97, 288
SfcI	CTRYAG	1 cut(s)	306
SsiI	CCGC	2 cut(s)	203, 330
SspI	AATATT	1 cut(s)	255
StyD4I	CCNGG	1 cut(s)	41
StyI	CCWWGG	1 cut(s)	134
TauI	GCSGC	1 cut(s)	333
Tru1I	TTAA	2 cut(s)	149, 350
Tru9I	TTAA	2 cut(s)	149, 350
TscAI	CASTG	1 cut(s)	30
TseI	GCWGC	5 cut(s)	94, 127, 130, 305, 343
TspRI	CASTG	1 cut(s)	30
Van91I	CCANNNNNTGG	1 cut(s)	265
XceI	RCATGY	2 cut(s)	9, 337

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.