Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005838.1

Orthogroup ID

OG0002717

Physical Location & Seq

Genomic Coordinates Forward (+)

35414 .. 40763

Gene Structure 5350 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005838.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 792 bp

atggttgttgttcaaggccttggaccagggccacgctacgggcatgtgatggcattggtggggcaaagatatctcatggcaattggtgggaatgatggtaaacggcctttagctgatgtttgggcgctggacacagctgccaagccatatgaatggcataagttggaaccagagggggaagtccaccaccatgcatgtatgcaagtgcaagtccaaggtcggatggtcttctcctcctttgtagagggagggatgcaaacagtgtgggatggccgttgggaatgggcaattgctcctggcgtctccccttctcccagatatcaacatgcagcagtttttgttaatgcacgcttgcatgtttccggaggggcccttggtggtgggcgcatggttgaagattcatcaagtgttggagtgttggatactgcagccggggtttggtgcgatacaaaatctgttgtcatgagtccaaggacaggtagatacagcgctgatgcagctggtggagatgctgcagttgaattgacacggcgttgcaggcatgcagctgctgcggttggactagctggtgccacagctgatgtgcactgttatgacatcctaacaaataaatggtctaggatcactccctttggagaaccaccaacaccaagggcagcacatgtagcaactgctgtaggaactatggttgttattcagggaggaattggtcctgctggtttgtctgctgaagatttacatgttcttgacctcactcagcaacggcctcgatggcacaggttaaacttttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005886 GO:0016020 GO:0044424 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Kelch_2 Kelch_4 Metallophos

Protein Analysis

263

Amino Acids

28.09

Weight (kDa)

7.21

Isoelectric Point (pI)

35.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002717)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G08420 AT1G08420 AT2G27210 AT2G27210
fragaria_vesca	FvH4_3g26300
malus_domestica	MD03G1156600.v1.1 MD03G1157300.v1.1 MD11G1174100.v1.1
prunus_persica	Prupe.6G145800_v2.0.a1 Prupe.6G145800_v2.0.a1 Prupe.6G145800_v2.0.a1 Prupe.6G145800_v2.0.a1 Prupe.6G145800_v2.0.a1
pyrus_communis	pycom03g11040 pycom11g14860
rosa_chinensis	RchiOBHm_Chr5g0048611 RchiOBHm_Chr7g0219991 RchiOBHm_Chr7g0220001
rosa_laevigata	RLG00000034543
rosa_multiflora	Rmu_co8183230.1_g000001 Rmu_co8284673.1_g000001 Rmu_sc0005838.1_g000012 Rmu_sc0005838.1_g000013 Rmu_sc0007553.1_g000001 Rmu_sc0008151.1_g000001
rosa_roxburghii	Rroxscaffold_1G00033170 Rroxscaffold_3G00239830
rosa_rugosa	Rorug05G0240500 Rorug07G0188300
rosa_samantha	Rh5AG319700 Rh5CG355900 Rh7AG332100 Rh7CG349500 Rh7CG349600 Rh7DG327700 Rh7DG327800
rosa_wichuraiana	Rw0G021290 Rw5G029900 Rw7G027970

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	569
AccIII	TCCGGA	1 cut(s)	362
AciI	CCGC	1 cut(s)	554
AclWI	GGATC	1 cut(s)	629
AcoI	YGGCCR	1 cut(s)	271
AcuI	CTGAAG	1 cut(s)	750
AcyI	GRCGYC	1 cut(s)	300
AfeI	AGCGCT	1 cut(s)	490
AfiI	CCNNNNNNNGG	3 cut(s)	38, 438, 476
AflIII	ACRYGT	2 cut(s)	661, 739
AgsI	TTSAA	3 cut(s)	14, 395, 521
AjnI	CCWGG	2 cut(s)	25, 295
AluBI	AGCT	6 cut(s)	113, 137, 500, 548, 566, 578
AluI	AGCT	6 cut(s)	113, 137, 500, 548, 566, 578
Alw21I	GWGCWC	1 cut(s)	588
Alw26I	GTCTC	1 cut(s)	307
Alw44I	GTGCAC	1 cut(s)	584
AlwI	GGATC	1 cut(s)	629
AlwNI	CAGNNNCTG	1 cut(s)	551
Aor13HI	TCCGGA	1 cut(s)	362
Aor51HI	AGCGCT	1 cut(s)	490
AoxI	GGCC	6 cut(s)	16, 29, 104, 271, 369, 764
ApaI	GGGCCC	1 cut(s)	373
ApaLI	GTGCAC	1 cut(s)	584
ApeKI	GCWGC	9 cut(s)	137, 329, 428, 497, 512, 545, 548, 551, 656
ArsI	GACNNNNNNTTYG	2 cut(s)	599, 631
AspLEI	GCGC	3 cut(s)	127, 387, 491
AspS9I	GGNCC	5 cut(s)	23, 29, 369, 370, 710
AsuC2I	CCSGG	1 cut(s)	433
AvaII	GGWCC	2 cut(s)	23, 710
BaeGI	GKGCMC	2 cut(s)	373, 588
BanI	GGYRCC	1 cut(s)	569
BanII	GRGCYC	1 cut(s)	373
BbsI	GAAGAC	1 cut(s)	220
Bbv12I	GWGCWC	1 cut(s)	588
BbvI	GCAGC	9 cut(s)	124, 341, 440, 499, 509, 535, 538, 557, 668
BccI	CCATC	5 cut(s)	43, 89, 217, 263, 765
BceAI	ACGGC	4 cut(s)	119, 258, 545, 779
BcgI	CGANNNNNNTGC	2 cut(s)	749, 783
BciT130I	CCWGG	2 cut(s)	27, 297
BciVI	GTATCC	1 cut(s)	415
BcnI	CCSGG	1 cut(s)	433
BcoDI	GTCTC	1 cut(s)	307
BfaI	CTAG	2 cut(s)	563, 618
BfmI	CTRYAG	3 cut(s)	426, 513, 675
BfoI	RGCGCY	2 cut(s)	128, 492
BfuI	GTATCC	1 cut(s)	415
BglI	GCCNNNNNGGC	1 cut(s)	772
BisI	GCNGC	9 cut(s)	138, 330, 429, 498, 513, 546, 549, 552, 657
BlsI	GCNGC	9 cut(s)	139, 331, 430, 499, 514, 547, 550, 553, 658
Bme1390I	CCNGG	3 cut(s)	27, 297, 433
Bme18I	GGWCC	2 cut(s)	23, 710
BmgT120I	GGNCC	5 cut(s)	23, 29, 369, 370, 710
BmiI	GGNNCC	4 cut(s)	168, 370, 371, 571
BmrFI	CCNGG	3 cut(s)	27, 297, 433
BmsI	GCATC	3 cut(s)	243, 484, 499
BpiI	GAAGAC	1 cut(s)	220
BpuMI	CCSGG	1 cut(s)	433
BsaHI	GRCGYC	1 cut(s)	300
BsaJI	CCNNGG	7 cut(s)	19, 26, 214, 373, 432, 470, 650
BsaWI	WCCGGW	1 cut(s)	362
Bsc4I	CCNNNNNNNGG	3 cut(s)	38, 438, 476
BseAI	TCCGGA	1 cut(s)	362
BseBI	CCWGG	2 cut(s)	27, 297
BseDI	CCNNGG	7 cut(s)	19, 26, 214, 373, 432, 470, 650
BseGI	GGATG	4 cut(s)	228, 258, 274, 597
BseLI	CCNNNNNNNGG	3 cut(s)	38, 438, 476
BseMII	CTCAG	1 cut(s)	770
BseRI	GAGGAG	1 cut(s)	223
BseSI	GKGCMC	2 cut(s)	373, 588
BseXI	GCAGC	9 cut(s)	124, 341, 440, 499, 509, 535, 538, 557, 668
BshFI	GGCC	6 cut(s)	18, 31, 106, 273, 371, 766
BshNI	GGYRCC	1 cut(s)	569
BsiHKAI	GWGCWC	1 cut(s)	588
BsiSI	CCGG	2 cut(s)	363, 432
BslI	CCNNNNNNNGG	3 cut(s)	38, 438, 476
BsmAI	GTCTC	1 cut(s)	307
BsmBI	CGTCTC	1 cut(s)	307
BsnI	GGCC	6 cut(s)	18, 31, 106, 273, 371, 766
Bsp120I	GGGCCC	1 cut(s)	369
Bsp1286I	GDGCHC	2 cut(s)	373, 588
Bsp13I	TCCGGA	1 cut(s)	362
Bsp143I	GATC	1 cut(s)	621
BspACI	CCGC	1 cut(s)	554
BspANI	GGCC	6 cut(s)	18, 31, 106, 273, 371, 766
BspCNI	CTCAG	1 cut(s)	769
BspEI	TCCGGA	1 cut(s)	362
BspHI	TCATGA	1 cut(s)	462
BspLI	GGNNCC	4 cut(s)	168, 370, 371, 571
BspMAI	CTGCAG	2 cut(s)	430, 517
BspPI	GGATC	1 cut(s)	629
BspT107I	GGYRCC	1 cut(s)	569
BssECI	CCNNGG	7 cut(s)	19, 26, 214, 373, 432, 470, 650
BssMI	GATC	1 cut(s)	621
BssNI	GRCGYC	1 cut(s)	300
BssT1I	CCWWGG	5 cut(s)	19, 214, 373, 470, 650
Bst2UI	CCWGG	2 cut(s)	27, 297
Bst4CI	ACNGT	2 cut(s)	262, 590
BstACI	GRCGYC	1 cut(s)	300
BstAPI	GCANNNNNTGC	1 cut(s)	551
BstC8I	GCNNGC	4 cut(s)	349, 353, 539, 543
BstDEI	CTNAG	1 cut(s)	756
BstF5I	GGATG	4 cut(s)	228, 258, 274, 597
BstH2I	RGCGCY	2 cut(s)	128, 492
BstHHI	GCGC	3 cut(s)	127, 387, 491
BstKTI	GATC	1 cut(s)	624
BstMAI	GTCTC	1 cut(s)	307
BstMBI	GATC	1 cut(s)	621
BstMWI	GCNNNNNNNGC	5 cut(s)	497, 538, 551, 665, 772
BstNI	CCWGG	2 cut(s)	27, 297
BstNSI	RCATGY	7 cut(s)	47, 198, 329, 359, 545, 665, 743
BstSCI	CCNGG	3 cut(s)	25, 295, 431
BstSFI	CTRYAG	3 cut(s)	426, 513, 675
BstSLI	GKGCMC	2 cut(s)	373, 588
BstV1I	GCAGC	9 cut(s)	124, 341, 440, 499, 509, 535, 538, 557, 668
BstV2I	GAAGAC	1 cut(s)	220
BstXI	CCANNNNNNTGG	1 cut(s)	153
BsuI	GTATCC	1 cut(s)	415
BsuRI	GGCC	6 cut(s)	18, 31, 106, 273, 371, 766
BtsCI	GGATG	4 cut(s)	228, 258, 274, 597
BtsIMutI	CAGTG	2 cut(s)	267, 586
Cac8I	GCNNGC	4 cut(s)	349, 353, 539, 543
CaiI	CAGNNNCTG	1 cut(s)	551
CciI	TCATGA	1 cut(s)	462
CfoI	GCGC	3 cut(s)	127, 387, 491
Cfr13I	GGNCC	5 cut(s)	23, 29, 369, 370, 710
CseI	GACGC	1 cut(s)	289
CspCI	CAANNNNNGTGG	2 cut(s)	245, 280
DdeI	CTNAG	1 cut(s)	756
DpnI	GATC	1 cut(s)	623
DpnII	GATC	1 cut(s)	621
EaeI	YGGCCR	1 cut(s)	271
Eco130I	CCWWGG	5 cut(s)	19, 214, 373, 470, 650
Eco147I	AGGCCT	1 cut(s)	18
Eco24I	GRGCYC	1 cut(s)	373
Eco32I	GATATC	2 cut(s)	71, 320
Eco47I	GGWCC	2 cut(s)	23, 710
Eco47III	AGCGCT	1 cut(s)	490
Eco57I	CTGAAG	1 cut(s)	750
EcoO109I	RGGNCCY	2 cut(s)	369, 370
EcoRII	CCWGG	2 cut(s)	25, 295
EcoRV	GATATC	2 cut(s)	71, 320
EcoT14I	CCWWGG	5 cut(s)	19, 214, 373, 470, 650
EcoT22I	ATGCAT	1 cut(s)	196
EcoT38I	GRGCYC	1 cut(s)	373
ErhI	CCWWGG	5 cut(s)	19, 214, 373, 470, 650
Esp3I	CGTCTC	1 cut(s)	307
FauNDI	CATATG	1 cut(s)	148
Fnu4HI	GCNGC	9 cut(s)	138, 330, 429, 498, 513, 546, 549, 552, 657
FokI	GGATG	4 cut(s)	235, 265, 281, 584
FriOI	GRGCYC	1 cut(s)	373
Fsp4HI	GCNGC	9 cut(s)	138, 330, 429, 498, 513, 546, 549, 552, 657
FspBI	CTAG	2 cut(s)	563, 618
GlaI	GCGC	3 cut(s)	126, 386, 490
GluI	GCNGC	9 cut(s)	138, 330, 429, 498, 513, 546, 549, 552, 657
HaeII	RGCGCY	2 cut(s)	128, 492
HaeIII	GGCC	6 cut(s)	18, 31, 106, 273, 371, 766
HapII	CCGG	2 cut(s)	363, 432
HgaI	GACGC	1 cut(s)	289
HhaI	GCGC	3 cut(s)	127, 387, 491
Hin1I	GRCGYC	1 cut(s)	300
Hin6I	GCGC	3 cut(s)	125, 385, 489
HinP1I	GCGC	3 cut(s)	125, 385, 489
HinfI	GANTC	2 cut(s)	398, 466
HpaII	CCGG	2 cut(s)	363, 432
Hpy166II	GTNNAC	3 cut(s)	101, 184, 586
Hpy188I	TCNGA	1 cut(s)	222
Hpy188III	TCNNGA	3 cut(s)	363, 463, 746
Hpy8I	GTNNAC	3 cut(s)	101, 184, 586
HpyAV	CCTTC	1 cut(s)	318
HpyCH4III	ACNGT	2 cut(s)	262, 590
HpyF10VI	GCNNNNNNNGC	5 cut(s)	497, 538, 551, 665, 772
HpyF3I	CTNAG	1 cut(s)	756
Hsp92I	GRCGYC	1 cut(s)	300
HspAI	GCGC	3 cut(s)	125, 385, 489
Kpn2I	TCCGGA	1 cut(s)	362
Kzo9I	GATC	1 cut(s)	621
LmnI	GCTCC	1 cut(s)	298
Lsp1109I	GCAGC	9 cut(s)	124, 341, 440, 499, 509, 535, 538, 557, 668
LweI	GCATC	3 cut(s)	243, 484, 499
MaeI	CTAG	2 cut(s)	563, 618
MalI	GATC	1 cut(s)	623
MboI	GATC	1 cut(s)	621
MboII	GAAGA	3 cut(s)	220, 407, 743
MfeI	CAATTG	2 cut(s)	81, 288
MhlI	GDGCHC	2 cut(s)	373, 588
MluCI	AATT	4 cut(s)	81, 288, 521, 705
MlyI	GAGTC	1 cut(s)	475
MmeI	TCCRAC	5 cut(s)	144, 200, 391, 399, 538
MnlI	CCTC	8 cut(s)	166, 238, 242, 244, 359, 695, 761, 777
Mph1103I	ATGCAT	1 cut(s)	196
MroI	TCCGGA	1 cut(s)	362
MseI	TTAA	2 cut(s)	342, 782
MslI	CAYNNNNRTG	3 cut(s)	151, 189, 591
MspA1I	CMGCKG	4 cut(s)	137, 500, 548, 578
MspI	CCGG	2 cut(s)	363, 432
MspR9I	CCNGG	3 cut(s)	27, 297, 433
MunI	CAATTG	2 cut(s)	81, 288
MvaI	CCWGG	2 cut(s)	27, 297
MwoI	GCNNNNNNNGC	5 cut(s)	497, 538, 551, 665, 772
NciI	CCSGG	1 cut(s)	433
NdeI	CATATG	1 cut(s)	148
NdeII	GATC	1 cut(s)	621
NlaIV	GGNNCC	4 cut(s)	168, 370, 371, 571
NsiI	ATGCAT	1 cut(s)	196
NspI	RCATGY	7 cut(s)	47, 198, 329, 359, 545, 665, 743
PaeI	GCATGC	1 cut(s)	545
PagI	TCATGA	1 cut(s)	462
PceI	AGGCCT	1 cut(s)	18
PciI	ACATGT	2 cut(s)	661, 739
PfeI	GAWTC	1 cut(s)	398
PkrI	GCNGC	9 cut(s)	139, 331, 430, 499, 514, 547, 550, 553, 658
PleI	GAGTC	1 cut(s)	474
PpsI	GAGTC	1 cut(s)	474
PscI	ACATGT	2 cut(s)	661, 739
Psp6I	CCWGG	2 cut(s)	25, 295
PspGI	CCWGG	2 cut(s)	25, 295
PspN4I	GGNNCC	4 cut(s)	168, 370, 371, 571
PspOMI	GGGCCC	1 cut(s)	369
PspPI	GGNCC	5 cut(s)	23, 29, 369, 370, 710
PstI	CTGCAG	2 cut(s)	430, 517
PstNI	CAGNNNCTG	1 cut(s)	551
PvuII	CAGCTG	4 cut(s)	137, 500, 548, 578
RseI	CAYNNNNRTG	3 cut(s)	151, 189, 591
SaqAI	TTAA	2 cut(s)	342, 782
SatI	GCNGC	9 cut(s)	138, 330, 429, 498, 513, 546, 549, 552, 657
Sau3AI	GATC	1 cut(s)	621
Sau96I	GGNCC	5 cut(s)	23, 29, 369, 370, 710
SchI	GAGTC	1 cut(s)	475
ScrFI	CCNGG	3 cut(s)	27, 297, 433
SduI	GDGCHC	2 cut(s)	373, 588
SfaNI	GCATC	3 cut(s)	243, 484, 499
SfcI	CTRYAG	3 cut(s)	426, 513, 675
SinI	GGWCC	2 cut(s)	23, 710
SmiMI	CAYNNNNRTG	3 cut(s)	151, 189, 591
SphI	GCATGC	1 cut(s)	545
Sse9I	AATT	4 cut(s)	81, 288, 521, 705
SseBI	AGGCCT	1 cut(s)	18
SsiI	CCGC	1 cut(s)	554
SspMI	CTAG	2 cut(s)	563, 618
StuI	AGGCCT	1 cut(s)	18
StyD4I	CCNGG	3 cut(s)	25, 295, 431
StyI	CCWWGG	5 cut(s)	19, 214, 373, 470, 650
TaaI	ACNGT	2 cut(s)	262, 590
TaqI	TCGA	1 cut(s)	769
TasI	AATT	4 cut(s)	81, 288, 521, 705
TfiI	GAWTC	1 cut(s)	398
Tru1I	TTAA	2 cut(s)	342, 782
Tru9I	TTAA	2 cut(s)	342, 782
TscAI	CASTG	2 cut(s)	267, 593
TseI	GCWGC	9 cut(s)	137, 329, 428, 497, 512, 545, 548, 551, 656
TspDTI	ATGAA	2 cut(s)	165, 390
TspRI	CASTG	2 cut(s)	267, 593
VneI	GTGCAC	1 cut(s)	584
VpaK11BI	GGWCC	2 cut(s)	23, 710
XceI	RCATGY	7 cut(s)	47, 198, 329, 359, 545, 665, 743
XspI	CTAG	2 cut(s)	563, 618
Zsp2I	ATGCAT	1 cut(s)	196

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.