Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005838.1

Orthogroup ID

OG0002717

Physical Location & Seq

Genomic Coordinates Forward (+)

40834 .. 41154

Gene Structure 321 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005838.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 201 bp

atggttgttgttcaaggccttggaccagggccacgctacgggcatgtgatggcattggtgggccaaagatatctcatggcaattggtgggaatgatggtaaacggcctttagctgatgtttgggcgctggacacagctgccaagccatatgaatggcgtaagttggaaccagagggggagggtccaccaccatgcatgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005886 GO:0016020 GO:0044424 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Kelch_2 Kelch_4 Metallophos

Protein Analysis

66

Amino Acids

7.15

Weight (kDa)

6.54

Isoelectric Point (pI)

17.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002717)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G08420 AT1G08420 AT2G27210 AT2G27210
fragaria_vesca	FvH4_3g26300
malus_domestica	MD03G1156600.v1.1 MD03G1157300.v1.1 MD11G1174100.v1.1
prunus_persica	Prupe.6G145800_v2.0.a1 Prupe.6G145800_v2.0.a1 Prupe.6G145800_v2.0.a1 Prupe.6G145800_v2.0.a1 Prupe.6G145800_v2.0.a1
pyrus_communis	pycom03g11040 pycom11g14860
rosa_chinensis	RchiOBHm_Chr5g0048611 RchiOBHm_Chr7g0219991 RchiOBHm_Chr7g0220001
rosa_laevigata	RLG00000034543
rosa_multiflora	Rmu_co8183230.1_g000001 Rmu_co8284673.1_g000001 Rmu_sc0005838.1_g000012 Rmu_sc0005838.1_g000013 Rmu_sc0007553.1_g000001 Rmu_sc0008151.1_g000001
rosa_roxburghii	Rroxscaffold_1G00033170 Rroxscaffold_3G00239830
rosa_rugosa	Rorug05G0240500 Rorug07G0188300
rosa_samantha	Rh5AG319700 Rh5CG355900 Rh7AG332100 Rh7CG349500 Rh7CG349600 Rh7DG327700 Rh7DG327800
rosa_wichuraiana	Rw0G021290 Rw5G029900 Rw7G027970

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfiI	CCNNNNNNNGG	1 cut(s)	38
AgsI	TTSAA	1 cut(s)	14
AjnI	CCWGG	1 cut(s)	25
AluBI	AGCT	2 cut(s)	113, 137
AluI	AGCT	2 cut(s)	113, 137
AoxI	GGCC	4 cut(s)	16, 29, 61, 104
ApeKI	GCWGC	1 cut(s)	137
AspLEI	GCGC	1 cut(s)	127
AspS9I	GGNCC	4 cut(s)	23, 29, 61, 182
AvaII	GGWCC	2 cut(s)	23, 182
BbvI	GCAGC	1 cut(s)	124
BccI	CCATC	2 cut(s)	43, 89
BceAI	ACGGC	1 cut(s)	119
BciT130I	CCWGG	1 cut(s)	27
BfoI	RGCGCY	1 cut(s)	128
BisI	GCNGC	1 cut(s)	138
BlsI	GCNGC	1 cut(s)	139
Bme1390I	CCNGG	1 cut(s)	27
Bme18I	GGWCC	2 cut(s)	23, 182
BmgT120I	GGNCC	4 cut(s)	23, 29, 61, 182
BmiI	GGNNCC	2 cut(s)	168, 183
BmrFI	CCNGG	1 cut(s)	27
BsaJI	CCNNGG	2 cut(s)	19, 26
Bsc4I	CCNNNNNNNGG	1 cut(s)	38
BseBI	CCWGG	1 cut(s)	27
BseDI	CCNNGG	2 cut(s)	19, 26
BseLI	CCNNNNNNNGG	1 cut(s)	38
BseXI	GCAGC	1 cut(s)	124
BshFI	GGCC	4 cut(s)	18, 31, 63, 106
BslI	CCNNNNNNNGG	1 cut(s)	38
BsnI	GGCC	4 cut(s)	18, 31, 63, 106
BspANI	GGCC	4 cut(s)	18, 31, 63, 106
BspLI	GGNNCC	2 cut(s)	168, 183
BssECI	CCNNGG	2 cut(s)	19, 26
BssT1I	CCWWGG	1 cut(s)	19
Bst2UI	CCWGG	1 cut(s)	27
BstH2I	RGCGCY	1 cut(s)	128
BstHHI	GCGC	1 cut(s)	127
BstNI	CCWGG	1 cut(s)	27
BstNSI	RCATGY	2 cut(s)	47, 199
BstSCI	CCNGG	1 cut(s)	25
BstV1I	GCAGC	1 cut(s)	124
BstXI	CCANNNNNNTGG	1 cut(s)	153
BsuRI	GGCC	4 cut(s)	18, 31, 63, 106
CfoI	GCGC	1 cut(s)	127
Cfr13I	GGNCC	4 cut(s)	23, 29, 61, 182
CviAII	CATG	4 cut(s)	44, 76, 192, 196
CviJI	RGCY	7 cut(s)	18, 31, 63, 106, 113, 137, 145
CviKI_1	RGCY	7 cut(s)	18, 31, 63, 106, 113, 137, 145
Eco130I	CCWWGG	1 cut(s)	19
Eco147I	AGGCCT	1 cut(s)	18
Eco32I	GATATC	1 cut(s)	71
Eco47I	GGWCC	2 cut(s)	23, 182
EcoRII	CCWGG	1 cut(s)	25
EcoRV	GATATC	1 cut(s)	71
EcoT14I	CCWWGG	1 cut(s)	19
EcoT22I	ATGCAT	1 cut(s)	197
ErhI	CCWWGG	1 cut(s)	19
FaeI	CATG	4 cut(s)	47, 79, 195, 199
FaiI	YATR	6 cut(s)	45, 77, 148, 150, 193, 197
FatI	CATG	4 cut(s)	43, 75, 191, 195
FauNDI	CATATG	1 cut(s)	148
Fnu4HI	GCNGC	1 cut(s)	138
Fsp4HI	GCNGC	1 cut(s)	138
GlaI	GCGC	1 cut(s)	126
GluI	GCNGC	1 cut(s)	138
HaeII	RGCGCY	1 cut(s)	128
HaeIII	GGCC	4 cut(s)	18, 31, 63, 106
HhaI	GCGC	1 cut(s)	127
Hin1II	CATG	4 cut(s)	47, 79, 195, 199
Hin6I	GCGC	1 cut(s)	125
HinP1I	GCGC	1 cut(s)	125
Hpy166II	GTNNAC	2 cut(s)	101, 185
Hpy8I	GTNNAC	2 cut(s)	101, 185
HpyCH4V	TGCA	1 cut(s)	195
Hsp92II	CATG	4 cut(s)	47, 79, 195, 199
HspAI	GCGC	1 cut(s)	125
LpnPI	CCDG	4 cut(s)	12, 39, 113, 183
Lsp1109I	GCAGC	1 cut(s)	124
MfeI	CAATTG	1 cut(s)	81
MluCI	AATT	1 cut(s)	81
MmeI	TCCRAC	1 cut(s)	144
MnlI	CCTC	2 cut(s)	166, 172
Mph1103I	ATGCAT	1 cut(s)	197
MslI	CAYNNNNRTG	2 cut(s)	151, 190
MspA1I	CMGCKG	1 cut(s)	137
MspR9I	CCNGG	1 cut(s)	27
MunI	CAATTG	1 cut(s)	81
MvaI	CCWGG	1 cut(s)	27
NdeI	CATATG	1 cut(s)	148
NlaIII	CATG	4 cut(s)	47, 79, 195, 199
NlaIV	GGNNCC	2 cut(s)	168, 183
NsiI	ATGCAT	1 cut(s)	197
NspI	RCATGY	2 cut(s)	47, 199
PceI	AGGCCT	1 cut(s)	18
PkrI	GCNGC	1 cut(s)	139
Psp6I	CCWGG	1 cut(s)	25
PspGI	CCWGG	1 cut(s)	25
PspN4I	GGNNCC	2 cut(s)	168, 183
PspPI	GGNCC	4 cut(s)	23, 29, 61, 182
PvuII	CAGCTG	1 cut(s)	137
RseI	CAYNNNNRTG	2 cut(s)	151, 190
SatI	GCNGC	1 cut(s)	138
Sau96I	GGNCC	4 cut(s)	23, 29, 61, 182
ScrFI	CCNGG	1 cut(s)	27
SetI	ASST	2 cut(s)	115, 139
SinI	GGWCC	2 cut(s)	23, 182
SmiMI	CAYNNNNRTG	2 cut(s)	151, 190
Sse9I	AATT	1 cut(s)	81
SseBI	AGGCCT	1 cut(s)	18
StuI	AGGCCT	1 cut(s)	18
StyD4I	CCNGG	1 cut(s)	25
StyI	CCWWGG	1 cut(s)	19
TasI	AATT	1 cut(s)	81
TseI	GCWGC	1 cut(s)	137
TspDTI	ATGAA	1 cut(s)	165
VpaK11BI	GGWCC	2 cut(s)	23, 182
XceI	RCATGY	2 cut(s)	47, 199
Zsp2I	ATGCAT	1 cut(s)	197

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.