Rmu_co8286187.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8286187.1
Physical Location & Seq
Reverse (-)
1 .. 824
824 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8286187.1_g000001.1.cds

Sequence Viewer

Length: 465 bp
atgcatgtgcggcggtcatcaaaactgatcaccactagggttttaagtacaccctggatctaccaaagagttacaacttacaaccatatgttgtactcaaaacctactcctcatgatattgtctctgaagtctcagcacaaaaatttcagggacaagcagctcaaggtattgatatcgagcaatttcaaggagtattaccagctgaactagaccagaagttatgccatgtgctcatcgaacagcaggaaagccaaattgtggagctggaatccgaactgcagtcggcccaatccaaactccaagaaaaagaaactgaacttcaagcattgaaggactgtgttaaacgcctaactcagttatccctttcaactgtctcagatgatgaaaatgaggctcacaatgaacaagagcagatcactggttggaattacaacacggagagatctgagtcaataaaaccagtg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

155

Amino Acids

17.78

Weight (kDa)

5.1

Isoelectric Point (pI)

64.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 259
AciI CCGC 2 cut(s) 10, 13
AclWI GGATC 1 cut(s) 65
AcsI RAATTY 1 cut(s) 143
AcuI CTGAAG 1 cut(s) 147
AfaI GTAC 2 cut(s) 49, 95
AfiI CCNNNNNNNGG 1 cut(s) 259
AgsI TTSAA 4 cut(s) 188, 323, 331, 369
AjnI CCWGG 1 cut(s) 53
AluBI AGCT 3 cut(s) 161, 203, 265
AluI AGCT 3 cut(s) 161, 203, 265
Alw21I GWGCWC 1 cut(s) 234
Alw26I GTCTC 3 cut(s) 127, 136, 379
AlwI GGATC 1 cut(s) 65
AoxI GGCC 1 cut(s) 285
ApeKI GCWGC 1 cut(s) 158
ApoI RAATTY 1 cut(s) 143
AspS9I GGNCC 1 cut(s) 286
AsuHPI GGTGA 1 cut(s) 22
Bbv12I GWGCWC 1 cut(s) 234
BbvI GCAGC 1 cut(s) 170
BciT130I CCWGG 1 cut(s) 55
BclI TGATCA 1 cut(s) 27
BcoDI GTCTC 3 cut(s) 127, 136, 379
BfaI CTAG 2 cut(s) 36, 209
BfmI CTRYAG 1 cut(s) 278
BglII AGATCT 1 cut(s) 443
BisI GCNGC 2 cut(s) 11, 159
BlsI GCNGC 2 cut(s) 12, 160
Bme1390I CCNGG 1 cut(s) 55
BmgT120I GGNCC 1 cut(s) 286
BmrFI CCNGG 1 cut(s) 55
BpuEI CTTGAG 1 cut(s) 147
BsaJI CCNNGG 1 cut(s) 53
Bsc4I CCNNNNNNNGG 1 cut(s) 259
Bse1I ACTGG 2 cut(s) 424, 461
BseBI CCWGG 1 cut(s) 55
BseDI CCNNGG 1 cut(s) 53
BseLI CCNNNNNNNGG 1 cut(s) 259
BseMII CTCAG 4 cut(s) 147, 368, 390, 438
BseNI ACTGG 2 cut(s) 424, 461
BseRI GAGGAG 1 cut(s) 99
BseXI GCAGC 1 cut(s) 170
BshFI GGCC 1 cut(s) 287
BsiHKAI GWGCWC 1 cut(s) 234
BslFI GGGAC 1 cut(s) 165
BslI CCNNNNNNNGG 1 cut(s) 259
BsmAI GTCTC 3 cut(s) 127, 136, 379
BsmFI GGGAC 1 cut(s) 165
BsnI GGCC 1 cut(s) 287
Bsp1286I GDGCHC 1 cut(s) 234
Bsp143I GATC 4 cut(s) 27, 57, 414, 443
BspACI CCGC 2 cut(s) 10, 13
BspANI GGCC 1 cut(s) 287
BspCNI CTCAG 4 cut(s) 146, 367, 389, 439
BspHI TCATGA 1 cut(s) 112
BspMAI CTGCAG 1 cut(s) 282
BspPI GGATC 1 cut(s) 65
BsrI ACTGG 2 cut(s) 424, 461
BssECI CCNNGG 1 cut(s) 53
BssMI GATC 4 cut(s) 27, 57, 414, 443
Bst2UI CCWGG 1 cut(s) 55
Bst4CI ACNGT 2 cut(s) 338, 373
BstDEI CTNAG 4 cut(s) 133, 354, 376, 447
BstKTI GATC 4 cut(s) 30, 60, 417, 446
BstMAI GTCTC 3 cut(s) 127, 136, 379
BstMBI GATC 4 cut(s) 27, 57, 414, 443
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstNI CCWGG 1 cut(s) 55
BstNSI RCATGY 1 cut(s) 8
BstSCI CCNGG 1 cut(s) 53
BstSFI CTRYAG 1 cut(s) 278
BstV1I GCAGC 1 cut(s) 170
BstX2I RGATCY 2 cut(s) 57, 443
BstYI RGATCY 2 cut(s) 57, 443
BsuRI GGCC 1 cut(s) 287
BtsIMutI CAGTG 1 cut(s) 417
CciI TCATGA 1 cut(s) 112
Cfr13I GGNCC 1 cut(s) 286
Csp6I GTAC 2 cut(s) 48, 94
CviAII CATG 3 cut(s) 5, 113, 227
CviJI RGCY 6 cut(s) 161, 203, 252, 265, 287, 395
CviKI_1 RGCY 6 cut(s) 161, 203, 252, 265, 287, 395
CviQI GTAC 2 cut(s) 48, 94
DdeI CTNAG 4 cut(s) 133, 354, 376, 447
DpnI GATC 4 cut(s) 29, 59, 416, 445
DpnII GATC 4 cut(s) 27, 57, 414, 443
Eco32I GATATC 1 cut(s) 175
Eco57I CTGAAG 1 cut(s) 147
EcoRII CCWGG 1 cut(s) 53
EcoRV GATATC 1 cut(s) 175
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 3 cut(s) 8, 116, 230
FaiI YATR 6 cut(s) 6, 87, 89, 114, 223, 228
FaqI GGGAC 1 cut(s) 165
FatI CATG 3 cut(s) 4, 112, 226
FauNDI CATATG 1 cut(s) 87
FbaI TGATCA 1 cut(s) 27
Fnu4HI GCNGC 2 cut(s) 11, 159
Fsp4HI GCNGC 2 cut(s) 11, 159
FspBI CTAG 2 cut(s) 36, 209
GluI GCNGC 2 cut(s) 11, 159
HaeIII GGCC 1 cut(s) 287
Hin1II CATG 3 cut(s) 8, 116, 230
HinfI GANTC 2 cut(s) 269, 449
HphI GGTGA 1 cut(s) 22
Hpy166II GTNNAC 1 cut(s) 50
Hpy188I TCNGA 4 cut(s) 127, 274, 379, 448
Hpy188III TCNNGA 1 cut(s) 113
Hpy8I GTNNAC 1 cut(s) 50
HpyAV CCTTC 1 cut(s) 325
HpyCH4III ACNGT 2 cut(s) 338, 373
HpyCH4V TGCA 2 cut(s) 4, 280
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
HpyF3I CTNAG 4 cut(s) 133, 354, 376, 447
Hsp92II CATG 3 cut(s) 8, 116, 230
Ksp22I TGATCA 1 cut(s) 27
Kzo9I GATC 4 cut(s) 27, 57, 414, 443
LmnI GCTCC 1 cut(s) 262
LpnPI CCDG 8 cut(s) 40, 67, 134, 213, 227, 230, 251, 405
Lsp1109I GCAGC 1 cut(s) 170
MaeI CTAG 2 cut(s) 36, 209
MaeIII GTNAC 1 cut(s) 70
MalI GATC 4 cut(s) 29, 59, 416, 445
MboI GATC 4 cut(s) 27, 57, 414, 443
MflI RGATCY 2 cut(s) 57, 443
MhlI GDGCHC 1 cut(s) 234
MluCI AATT 4 cut(s) 143, 182, 255, 427
MlyI GAGTC 1 cut(s) 458
MmeI TCCRAC 1 cut(s) 404
MnlI CCTC 2 cut(s) 120, 385
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 44, 342
MspA1I CMGCKG 1 cut(s) 203
MspR9I CCNGG 1 cut(s) 55
MvaI CCWGG 1 cut(s) 55
MwoI GCNNNNNNNGC 1 cut(s) 10
NdeI CATATG 1 cut(s) 87
NdeII GATC 4 cut(s) 27, 57, 414, 443
NlaIII CATG 3 cut(s) 8, 116, 230
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 8
PagI TCATGA 1 cut(s) 112
PfeI GAWTC 1 cut(s) 269
PflMI CCANNNNNTGG 1 cut(s) 259
PkrI GCNGC 2 cut(s) 12, 160
PleI GAGTC 1 cut(s) 457
PpsI GAGTC 1 cut(s) 457
Psp6I CCWGG 1 cut(s) 53
PspGI CCWGG 1 cut(s) 53
PspPI GGNCC 1 cut(s) 286
PstI CTGCAG 1 cut(s) 282
PsuI RGATCY 2 cut(s) 57, 443
PvuII CAGCTG 1 cut(s) 203
RsaI GTAC 2 cut(s) 49, 95
RsaNI GTAC 2 cut(s) 48, 94
SaqAI TTAA 2 cut(s) 44, 342
SatI GCNGC 2 cut(s) 11, 159
Sau3AI GATC 4 cut(s) 27, 57, 414, 443
Sau96I GGNCC 1 cut(s) 286
SchI GAGTC 1 cut(s) 458
ScrFI CCNGG 1 cut(s) 55
SduI GDGCHC 1 cut(s) 234
SetI ASST 5 cut(s) 106, 163, 169, 205, 267
SfcI CTRYAG 1 cut(s) 278
SmlI CTYRAG 1 cut(s) 162
SmoI CTYRAG 1 cut(s) 162
Sse9I AATT 4 cut(s) 143, 182, 255, 427
SsiI CCGC 2 cut(s) 10, 13
SspMI CTAG 2 cut(s) 36, 209
StyD4I CCNGG 1 cut(s) 53
TaaI ACNGT 2 cut(s) 338, 373
TaqI TCGA 2 cut(s) 177, 237
TasI AATT 4 cut(s) 143, 182, 255, 427
TatI WGTACW 2 cut(s) 47, 93
TauI GCSGC 1 cut(s) 13
TfiI GAWTC 1 cut(s) 269
Tru1I TTAA 2 cut(s) 44, 342
Tru9I TTAA 2 cut(s) 44, 342
TscAI CASTG 1 cut(s) 424
TseI GCWGC 1 cut(s) 158
TspDTI ATGAA 2 cut(s) 399, 417
TspGWI ACGGA 1 cut(s) 452
TspRI CASTG 1 cut(s) 424
Van91I CCANNNNNTGG 1 cut(s) 259
XapI RAATTY 1 cut(s) 143
XceI RCATGY 1 cut(s) 8
XspI CTAG 2 cut(s) 36, 209
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.