Rh5CG196300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
19531930 .. 19534987
3058 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG196300.1

Sequence Viewer

Length: 291 bp
ATGCCCACCGCCGAGATCACGGACTCTGATCCGCAAAACGACGCTGTCTTAGACGATGCGACTCCGCTGCGCTCCATCGCTTCTGTTTCTCGGTCTCTGGAGCTGTCGTGGGAGAGCGACTGTGAGGATCAGGTCAAGGAGGGGATCGTTAGGTTTTCGACCAATGGCGGGAGTGGCAAGAAGAAGAAAAAGACAAGGTTTTGGTTGAAGAAGAAGGGAGTAGTTAATAATGTTACTAAGAACTTGGGTGATGATTCCATCTTAAAGGCCTTGAGGTATTTCTTGTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.71

Weight (kDa)

8.76

Isoelectric Point (pI)

35.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 9, 32, 65, 168
AclWI GGATC 3 cut(s) 23, 135, 152
AfiI CCNNNNNNNGG 1 cut(s) 168
AgsI TTSAA 1 cut(s) 208
AluBI AGCT 1 cut(s) 103
AluI AGCT 1 cut(s) 103
Alw26I GTCTC 1 cut(s) 99
AlwI GGATC 3 cut(s) 23, 135, 152
AoxI GGCC 1 cut(s) 267
ApeKI GCWGC 1 cut(s) 67
AspLEI GCGC 1 cut(s) 72
AsuHPI GGTGA 1 cut(s) 260
BbvI GCAGC 1 cut(s) 54
BccI CCATC 2 cut(s) 83, 266
BcgI CGANNNNNNTGC 2 cut(s) 49, 83
BcoDI GTCTC 1 cut(s) 99
BfaI CTAG 1 cut(s) 289
BisI GCNGC 1 cut(s) 68
BlsI GCNGC 1 cut(s) 69
BmsI GCATC 1 cut(s) 46
BpmI CTGGAG 1 cut(s) 119
BsaI GGTCTC 1 cut(s) 99
BsaXI ACNNNNNCTCC 2 cut(s) 92, 122
Bsc4I CCNNNNNNNGG 1 cut(s) 168
BseLI CCNNNNNNNGG 1 cut(s) 168
BseXI GCAGC 1 cut(s) 54
BshFI GGCC 1 cut(s) 269
BslI CCNNNNNNNGG 1 cut(s) 168
BsmAI GTCTC 1 cut(s) 99
BsnI GGCC 1 cut(s) 269
Bso31I GGTCTC 1 cut(s) 99
Bsp143I GATC 4 cut(s) 15, 28, 127, 144
BspACI CCGC 4 cut(s) 9, 32, 65, 168
BspANI GGCC 1 cut(s) 269
BspPI GGATC 3 cut(s) 23, 135, 152
BspTNI GGTCTC 1 cut(s) 99
BssMI GATC 4 cut(s) 15, 28, 127, 144
Bst4CI ACNGT 1 cut(s) 122
BstDEI CTNAG 2 cut(s) 49, 237
BstHHI GCGC 1 cut(s) 72
BstKTI GATC 4 cut(s) 18, 31, 130, 147
BstMAI GTCTC 1 cut(s) 99
BstMBI GATC 4 cut(s) 15, 28, 127, 144
BstMWI GCNNNNNNNGC 1 cut(s) 174
BstV1I GCAGC 1 cut(s) 54
BsuRI GGCC 1 cut(s) 269
BtgZI GCGATG 1 cut(s) 61
CfoI GCGC 1 cut(s) 72
CseI GACGC 1 cut(s) 50
CviJI RGCY 2 cut(s) 103, 269
CviKI_1 RGCY 2 cut(s) 103, 269
DdeI CTNAG 2 cut(s) 49, 237
DpnI GATC 4 cut(s) 17, 30, 129, 146
DpnII GATC 4 cut(s) 15, 28, 127, 144
Eco147I AGGCCT 1 cut(s) 269
Eco31I GGTCTC 1 cut(s) 99
FauI CCCGC 1 cut(s) 161
Fnu4HI GCNGC 1 cut(s) 68
Fsp4HI GCNGC 1 cut(s) 68
FspBI CTAG 1 cut(s) 289
GlaI GCGC 1 cut(s) 71
GluI GCNGC 1 cut(s) 68
GsuI CTGGAG 1 cut(s) 119
HaeIII GGCC 1 cut(s) 269
HgaI GACGC 1 cut(s) 50
HhaI GCGC 1 cut(s) 72
Hin6I GCGC 1 cut(s) 70
HinP1I GCGC 1 cut(s) 70
HinfI GANTC 3 cut(s) 23, 61, 254
HphI GGTGA 1 cut(s) 260
Hpy188I TCNGA 1 cut(s) 28
Hpy188III TCNNGA 1 cut(s) 98
Hpy99I CGWCG 1 cut(s) 44
HpyAV CCTTC 1 cut(s) 208
HpyCH4III ACNGT 1 cut(s) 122
HpyF10VI GCNNNNNNNGC 1 cut(s) 174
HpyF3I CTNAG 2 cut(s) 49, 237
HspAI GCGC 1 cut(s) 70
Kzo9I GATC 4 cut(s) 15, 28, 127, 144
LmnI GCTCC 2 cut(s) 77, 100
LpnPI CCDG 2 cut(s) 83, 116
Lsp1109I GCAGC 1 cut(s) 54
LweI GCATC 1 cut(s) 46
MaeI CTAG 1 cut(s) 289
MaeIII GTNAC 1 cut(s) 232
MalI GATC 4 cut(s) 17, 30, 129, 146
MboI GATC 4 cut(s) 15, 28, 127, 144
MboII GAAGA 4 cut(s) 193, 196, 220, 223
MlyI GAGTC 2 cut(s) 17, 55
MnlI CCTC 3 cut(s) 118, 133, 267
MseI TTAA 2 cut(s) 225, 263
MspA1I CMGCKG 1 cut(s) 67
MwoI GCNNNNNNNGC 1 cut(s) 174
NdeII GATC 4 cut(s) 15, 28, 127, 144
NmeAIII GCCGAG 1 cut(s) 37
PceI AGGCCT 1 cut(s) 269
PfeI GAWTC 1 cut(s) 254
PflFI GACNNNGTC 1 cut(s) 44
PkrI GCNGC 1 cut(s) 69
PleI GAGTC 2 cut(s) 17, 55
PpsI GAGTC 2 cut(s) 17, 55
PsrI GAACNNNNNNTAC 1 cut(s) 269
PsyI GACNNNGTC 1 cut(s) 44
SaqAI TTAA 2 cut(s) 225, 263
SatI GCNGC 1 cut(s) 68
Sau3AI GATC 4 cut(s) 15, 28, 127, 144
SchI GAGTC 2 cut(s) 17, 55
SetI ASST 5 cut(s) 105, 135, 155, 200, 278
SfaNI GCATC 1 cut(s) 46
SmlI CTYRAG 1 cut(s) 271
SmoI CTYRAG 1 cut(s) 271
SseBI AGGCCT 1 cut(s) 269
SsiI CCGC 4 cut(s) 9, 32, 65, 168
SspMI CTAG 1 cut(s) 289
StuI AGGCCT 1 cut(s) 269
TaaI ACNGT 1 cut(s) 122
TaqI TCGA 1 cut(s) 158
TaqII GACCGA 1 cut(s) 81
TfiI GAWTC 1 cut(s) 254
Tru1I TTAA 2 cut(s) 225, 263
Tru9I TTAA 2 cut(s) 225, 263
TseI GCWGC 1 cut(s) 67
TspGWI ACGGA 1 cut(s) 35
Tth111I GACNNNGTC 1 cut(s) 44
XspI CTAG 1 cut(s) 289
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.