Rmu_sc0000326.1_g000009

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000326.1
Physical Location & Seq
Reverse (-)
55669 .. 56948
1280 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000326.1_g000009.1.cds

Sequence Viewer

Length: 813 bp
atgtacatgatgactgctggaaaagcggaaatcaataagctgaacacaaccatggatgagactgcaaaagttgtgcaggagttaaaatctgagctaaataaaagaaaagcatcacagagtcagcaagtttcttgttctgaaagtgaagccaatacacaagttcagagccctagttgcaagcgtactcagacagaactcaagaagtcaagtgcagaaaacagtgaacctaattatatgagagcttccagttttcatatatttgatgatggcgaatgtccaagtagtgttcttacagaggatcaggagcctgagccagaggtgatggacatggatcaattggaagcagaacttgagtctgaactgcaaaagcttccatggtgctccacagaagctccccatcaagagggattcagaaatctgggaaaggatattgtctctgaagtctcagcacaaaaatttcagggacaagcagctcaaggtattgatatcgagcaatttcaaggagtattaccagctgaactagaccagaagttatgccatgtgctcatcgaacagcaggaaagccaaattgtggagctggaatccgaactgcagtcggcccaatccaaactccaagaaaaagaaactgaacttcaagcattgaaggactgtgttaaacgcctaactcagttatccctttcaactgtctcagatgatgaaaatgaggctcacaatgaacaagagcagatcactggttggaattacaacacggagagatctgagtcaataaaaccagtggttgggatgaaaagacctatagattctgaatcctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

270

Amino Acids

30.36

Weight (kDa)

4.51

Isoelectric Point (pI)

77.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 571, 779
AciI CCGC 1 cut(s) 26
AclWI GGATC 2 cut(s) 306, 339
AcsI RAATTY 1 cut(s) 455
AcuI CTGAAG 1 cut(s) 459
AfaI GTAC 2 cut(s) 5, 184
AfiI CCNNNNNNNGG 3 cut(s) 403, 571, 779
AgsI TTSAA 4 cut(s) 500, 635, 643, 681
AluBI AGCT 8 cut(s) 40, 94, 242, 370, 392, 473, 515, 577
AluI AGCT 8 cut(s) 40, 94, 242, 370, 392, 473, 515, 577
Alw21I GWGCWC 2 cut(s) 383, 546
Alw26I GTCTC 4 cut(s) 53, 439, 448, 691
AlwI GGATC 2 cut(s) 306, 339
AoxI GGCC 1 cut(s) 597
ApeKI GCWGC 1 cut(s) 470
ApoI RAATTY 1 cut(s) 455
AspS9I GGNCC 1 cut(s) 598
AsuHPI GGTGA 1 cut(s) 331
BanII GRGCYC 1 cut(s) 170
Bbv12I GWGCWC 2 cut(s) 383, 546
BbvI GCAGC 1 cut(s) 482
BccI CCATC 3 cut(s) 260, 316, 405
BcoDI GTCTC 4 cut(s) 53, 439, 448, 691
BfaI CTAG 2 cut(s) 171, 521
BfmI CTRYAG 2 cut(s) 590, 795
BglII AGATCT 1 cut(s) 755
BisI GCNGC 1 cut(s) 471
BlsI GCNGC 1 cut(s) 472
BmgT120I GGNCC 1 cut(s) 598
BmiI GGNNCC 1 cut(s) 306
BmsI GCATC 1 cut(s) 119
Bpu10I CCTNAGC 1 cut(s) 309
BpuEI CTTGAG 3 cut(s) 182, 371, 459
BsaJI CCNNGG 2 cut(s) 51, 374
BsaXI ACNNNNNCTCC 2 cut(s) 376, 406
Bsc4I CCNNNNNNNGG 3 cut(s) 403, 571, 779
Bse1I ACTGG 3 cut(s) 246, 736, 773
BseDI CCNNGG 2 cut(s) 51, 374
BseGI GGATG 2 cut(s) 61, 789
BseLI CCNNNNNNNGG 3 cut(s) 403, 571, 779
BseMII CTCAG 7 cut(s) 81, 200, 300, 459, 680, 702, 750
BseNI ACTGG 3 cut(s) 246, 736, 773
BseXI GCAGC 1 cut(s) 482
BsgI GTGCAG 2 cut(s) 95, 231
BshFI GGCC 1 cut(s) 599
BsiHKAI GWGCWC 2 cut(s) 383, 546
BslFI GGGAC 1 cut(s) 477
BslI CCNNNNNNNGG 3 cut(s) 403, 571, 779
BsmAI GTCTC 4 cut(s) 53, 439, 448, 691
BsmFI GGGAC 1 cut(s) 477
BsnI GGCC 1 cut(s) 599
Bsp1286I GDGCHC 3 cut(s) 170, 383, 546
Bsp1407I TGTACA 1 cut(s) 3
Bsp143I GATC 4 cut(s) 298, 331, 726, 755
Bsp19I CCATGG 2 cut(s) 51, 374
BspACI CCGC 1 cut(s) 26
BspANI GGCC 1 cut(s) 599
BspCNI CTCAG 7 cut(s) 82, 199, 301, 458, 679, 701, 751
BspLI GGNNCC 1 cut(s) 306
BspMAI CTGCAG 1 cut(s) 594
BspPI GGATC 2 cut(s) 306, 339
BsrGI TGTACA 1 cut(s) 3
BsrI ACTGG 3 cut(s) 246, 736, 773
BssECI CCNNGG 2 cut(s) 51, 374
BssMI GATC 4 cut(s) 298, 331, 726, 755
BssT1I CCWWGG 2 cut(s) 51, 374
Bst4CI ACNGT 3 cut(s) 221, 650, 685
BstAUI TGTACA 1 cut(s) 3
BstC8I GCNNGC 1 cut(s) 179
BstDEI CTNAG 7 cut(s) 90, 186, 309, 445, 666, 688, 759
BstDSI CCRYGG 2 cut(s) 51, 374
BstF5I GGATG 2 cut(s) 61, 789
BstKTI GATC 4 cut(s) 301, 334, 729, 758
BstMAI GTCTC 4 cut(s) 53, 439, 448, 691
BstMBI GATC 4 cut(s) 298, 331, 726, 755
BstMWI GCNNNNNNNGC 2 cut(s) 23, 174
BstSFI CTRYAG 2 cut(s) 590, 795
BstV1I GCAGC 1 cut(s) 482
BstX2I RGATCY 1 cut(s) 755
BstYI RGATCY 1 cut(s) 755
BsuRI GGCC 1 cut(s) 599
BtgI CCRYGG 2 cut(s) 51, 374
BtsCI GGATG 2 cut(s) 61, 789
BtsIMutI CAGTG 3 cut(s) 226, 729, 780
Cac8I GCNNGC 1 cut(s) 179
Cfr13I GGNCC 1 cut(s) 598
Csp6I GTAC 2 cut(s) 4, 183
CviAII CATG 5 cut(s) 7, 52, 328, 375, 539
CviQI GTAC 2 cut(s) 4, 183
DdeI CTNAG 7 cut(s) 90, 186, 309, 445, 666, 688, 759
DpnI GATC 4 cut(s) 300, 333, 728, 757
DpnII GATC 4 cut(s) 298, 331, 726, 755
Eco130I CCWWGG 2 cut(s) 51, 374
Eco24I GRGCYC 1 cut(s) 170
Eco32I GATATC 1 cut(s) 487
Eco57I CTGAAG 1 cut(s) 459
EcoRV GATATC 1 cut(s) 487
EcoT14I CCWWGG 2 cut(s) 51, 374
EcoT38I GRGCYC 1 cut(s) 170
ErhI CCWWGG 2 cut(s) 51, 374
FaeI CATG 5 cut(s) 10, 55, 331, 378, 542
FalI AAGNNNNNCTT 2 cut(s) 333, 365
FaqI GGGAC 1 cut(s) 477
FatI CATG 5 cut(s) 6, 51, 327, 374, 538
Fnu4HI GCNGC 1 cut(s) 471
FokI GGATG 2 cut(s) 68, 796
FriOI GRGCYC 1 cut(s) 170
Fsp4HI GCNGC 1 cut(s) 471
FspBI CTAG 2 cut(s) 171, 521
GluI GCNGC 1 cut(s) 471
HaeIII GGCC 1 cut(s) 599
Hin1II CATG 5 cut(s) 10, 55, 331, 378, 542
HindIII AAGCTT 1 cut(s) 368
HinfI GANTC 7 cut(s) 118, 353, 408, 581, 761, 800, 806
HphI GGTGA 1 cut(s) 331
Hpy166II GTNNAC 1 cut(s) 224
Hpy188III TCNNGA 4 cut(s) 199, 302, 401, 810
Hpy8I GTNNAC 1 cut(s) 224
HpyAV CCTTC 1 cut(s) 637
HpyCH4III ACNGT 3 cut(s) 221, 650, 685
HpyCH4V TGCA 6 cut(s) 65, 76, 177, 212, 364, 592
HpyF10VI GCNNNNNNNGC 2 cut(s) 23, 174
HpyF3I CTNAG 7 cut(s) 90, 186, 309, 445, 666, 688, 759
Hsp92II CATG 5 cut(s) 10, 55, 331, 378, 542
Kzo9I GATC 4 cut(s) 298, 331, 726, 755
LmnI GCTCC 4 cut(s) 304, 386, 397, 574
Lsp1109I GCAGC 1 cut(s) 482
LweI GCATC 1 cut(s) 119
MaeI CTAG 2 cut(s) 171, 521
MalI GATC 4 cut(s) 300, 333, 728, 757
MboI GATC 4 cut(s) 298, 331, 726, 755
MfeI CAATTG 1 cut(s) 335
MflI RGATCY 1 cut(s) 755
MhlI GDGCHC 3 cut(s) 170, 383, 546
MluCI AATT 6 cut(s) 229, 335, 455, 494, 567, 739
MlyI GAGTC 3 cut(s) 127, 362, 770
MmeI TCCRAC 1 cut(s) 716
MnlI CCTC 4 cut(s) 289, 310, 397, 697
MseI TTAA 2 cut(s) 83, 654
MslI CAYNNNNRTG 1 cut(s) 50
MspA1I CMGCKG 1 cut(s) 515
MunI CAATTG 1 cut(s) 335
MwoI GCNNNNNNNGC 2 cut(s) 23, 174
NcoI CCATGG 2 cut(s) 51, 374
NdeII GATC 4 cut(s) 298, 331, 726, 755
NlaIII CATG 5 cut(s) 10, 55, 331, 378, 542
NlaIV GGNNCC 1 cut(s) 306
PfeI GAWTC 4 cut(s) 408, 581, 800, 806
PflMI CCANNNNNTGG 2 cut(s) 571, 779
PkrI GCNGC 1 cut(s) 472
PleI GAGTC 3 cut(s) 126, 361, 769
PpsI GAGTC 3 cut(s) 126, 361, 769
PspN4I GGNNCC 1 cut(s) 306
PspPI GGNCC 1 cut(s) 598
PstI CTGCAG 1 cut(s) 594
PsuI RGATCY 1 cut(s) 755
PvuII CAGCTG 1 cut(s) 515
RsaI GTAC 2 cut(s) 5, 184
RsaNI GTAC 2 cut(s) 4, 183
RseI CAYNNNNRTG 1 cut(s) 50
SaqAI TTAA 2 cut(s) 83, 654
SatI GCNGC 1 cut(s) 471
Sau3AI GATC 4 cut(s) 298, 331, 726, 755
Sau96I GGNCC 1 cut(s) 598
SchI GAGTC 3 cut(s) 127, 362, 770
SduI GDGCHC 3 cut(s) 170, 383, 546
SfaNI GCATC 1 cut(s) 119
SfcI CTRYAG 2 cut(s) 590, 795
SmiMI CAYNNNNRTG 1 cut(s) 50
SmlI CTYRAG 3 cut(s) 197, 350, 474
SmoI CTYRAG 3 cut(s) 197, 350, 474
Sse9I AATT 6 cut(s) 229, 335, 455, 494, 567, 739
SsiI CCGC 1 cut(s) 26
SspMI CTAG 2 cut(s) 171, 521
StyI CCWWGG 2 cut(s) 51, 374
TaaI ACNGT 3 cut(s) 221, 650, 685
TaqI TCGA 2 cut(s) 489, 549
TasI AATT 6 cut(s) 229, 335, 455, 494, 567, 739
TatI WGTACW 1 cut(s) 3
TfiI GAWTC 4 cut(s) 408, 581, 800, 806
Tru1I TTAA 2 cut(s) 83, 654
Tru9I TTAA 2 cut(s) 83, 654
TscAI CASTG 3 cut(s) 226, 736, 780
TseI GCWGC 1 cut(s) 470
TspDTI ATGAA 4 cut(s) 242, 711, 729, 800
TspGWI ACGGA 1 cut(s) 764
TspRI CASTG 3 cut(s) 226, 736, 780
Van91I CCANNNNNTGG 2 cut(s) 571, 779
XapI RAATTY 1 cut(s) 455
XspI CTAG 2 cut(s) 171, 521
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.