Rh3BG372900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
47119298 .. 47120852
1555 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG372900.1

Sequence Viewer

Length: 330 bp
ATGCCCGCAGCCGAGATCACGGACTCTGATCCTCAAAACAACGCTGTCTTAGACGATGCGACTCCGCTGCTCTCCGTCGCTTCTGTTTCTCGGTCTTTGGTGCTGCCGTGGGAGAGCGACTGTGAGGATCAGGTCAAGGGGGGGATCGTTAGGTTTTCGACCGATGGCAGGAGAGGCAAGAAGAAGAAAAAGACAAGGTTTTGGTTGAAGAAGAAGGGAGTAGTTAATAATGTTACTAAGAACTTGGGTGATGATTCCATCTTAAAGGCCTTGAGCTTTAGGTTGTCAAACAACAACAAAATTCCAATTGGATTACTTCAACGATTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

109

Amino Acids

12.07

Weight (kDa)

9.86

Isoelectric Point (pI)

39.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 6, 65
AclWI GGATC 3 cut(s) 23, 135, 152
AcsI RAATTY 1 cut(s) 300
AfiI CCNNNNNNNGG 1 cut(s) 168
AgsI TTSAA 2 cut(s) 208, 320
AluBI AGCT 1 cut(s) 276
AluI AGCT 1 cut(s) 276
AlwI GGATC 3 cut(s) 23, 135, 152
AoxI GGCC 1 cut(s) 267
ApeKI GCWGC 3 cut(s) 8, 67, 103
ApoI RAATTY 1 cut(s) 300
AsuHPI GGTGA 1 cut(s) 260
BbvI GCAGC 3 cut(s) 20, 54, 90
BccI CCATC 2 cut(s) 158, 266
BceAI ACGGC 1 cut(s) 91
BcgI CGANNNNNNTGC 2 cut(s) 49, 83
BfaI CTAG 1 cut(s) 328
BisI GCNGC 3 cut(s) 9, 68, 104
BlsI GCNGC 3 cut(s) 10, 69, 105
BmsI GCATC 1 cut(s) 46
BpuEI CTTGAG 1 cut(s) 292
BsaJI CCNNGG 1 cut(s) 107
Bsc4I CCNNNNNNNGG 1 cut(s) 168
BseDI CCNNGG 1 cut(s) 107
BseLI CCNNNNNNNGG 1 cut(s) 168
BseXI GCAGC 3 cut(s) 20, 54, 90
Bsh1285I CGRYCG 1 cut(s) 162
BshFI GGCC 1 cut(s) 269
BsiEI CGRYCG 1 cut(s) 162
BslI CCNNNNNNNGG 1 cut(s) 168
BsnI GGCC 1 cut(s) 269
Bsp143I GATC 4 cut(s) 15, 28, 127, 144
BspACI CCGC 2 cut(s) 6, 65
BspANI GGCC 1 cut(s) 269
BspPI GGATC 3 cut(s) 23, 135, 152
BssECI CCNNGG 1 cut(s) 107
BssMI GATC 4 cut(s) 15, 28, 127, 144
Bst4CI ACNGT 1 cut(s) 122
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 2 cut(s) 49, 237
BstDSI CCRYGG 1 cut(s) 107
BstKTI GATC 4 cut(s) 18, 31, 130, 147
BstMBI GATC 4 cut(s) 15, 28, 127, 144
BstMCI CGRYCG 1 cut(s) 162
BstMWI GCNNNNNNNGC 1 cut(s) 174
BstV1I GCAGC 3 cut(s) 20, 54, 90
BsuRI GGCC 1 cut(s) 269
BtgI CCRYGG 1 cut(s) 107
Cac8I GCNNGC 1 cut(s) 6
CviJI RGCY 3 cut(s) 11, 269, 276
CviKI_1 RGCY 3 cut(s) 11, 269, 276
DdeI CTNAG 2 cut(s) 49, 237
DpnI GATC 4 cut(s) 17, 30, 129, 146
DpnII GATC 4 cut(s) 15, 28, 127, 144
Eco147I AGGCCT 1 cut(s) 269
FauI CCCGC 1 cut(s) 13
Fnu4HI GCNGC 3 cut(s) 9, 68, 104
Fsp4HI GCNGC 3 cut(s) 9, 68, 104
FspBI CTAG 1 cut(s) 328
GluI GCNGC 3 cut(s) 9, 68, 104
HaeIII GGCC 1 cut(s) 269
HinfI GANTC 4 cut(s) 23, 61, 254, 324
HphI GGTGA 1 cut(s) 260
Hpy188I TCNGA 1 cut(s) 28
Hpy99I CGWCG 1 cut(s) 80
HpyAV CCTTC 1 cut(s) 208
HpyCH4III ACNGT 1 cut(s) 122
HpyF10VI GCNNNNNNNGC 1 cut(s) 174
HpyF3I CTNAG 2 cut(s) 49, 237
Kzo9I GATC 4 cut(s) 15, 28, 127, 144
LpnPI CCDG 2 cut(s) 116, 154
Lsp1109I GCAGC 3 cut(s) 20, 54, 90
LweI GCATC 1 cut(s) 46
MaeI CTAG 1 cut(s) 328
MaeIII GTNAC 1 cut(s) 232
MalI GATC 4 cut(s) 17, 30, 129, 146
MboI GATC 4 cut(s) 15, 28, 127, 144
MboII GAAGA 4 cut(s) 193, 196, 220, 223
MfeI CAATTG 1 cut(s) 306
MluCI AATT 2 cut(s) 300, 306
MlyI GAGTC 2 cut(s) 17, 55
MnlI CCTC 3 cut(s) 42, 118, 167
MseI TTAA 2 cut(s) 225, 263
MspA1I CMGCKG 1 cut(s) 67
MunI CAATTG 1 cut(s) 306
MwoI GCNNNNNNNGC 1 cut(s) 174
NdeII GATC 4 cut(s) 15, 28, 127, 144
NmeAIII GCCGAG 1 cut(s) 37
PceI AGGCCT 1 cut(s) 269
PfeI GAWTC 2 cut(s) 254, 324
PkrI GCNGC 3 cut(s) 10, 69, 105
PleI GAGTC 2 cut(s) 17, 55
PpsI GAGTC 2 cut(s) 17, 55
SaqAI TTAA 2 cut(s) 225, 263
SatI GCNGC 3 cut(s) 9, 68, 104
Sau3AI GATC 4 cut(s) 15, 28, 127, 144
SchI GAGTC 2 cut(s) 17, 55
SetI ASST 5 cut(s) 135, 155, 200, 278, 284
SfaNI GCATC 1 cut(s) 46
SmlI CTYRAG 1 cut(s) 271
SmoI CTYRAG 1 cut(s) 271
Sse9I AATT 2 cut(s) 300, 306
SseBI AGGCCT 1 cut(s) 269
SsiI CCGC 2 cut(s) 6, 65
SspMI CTAG 1 cut(s) 328
StuI AGGCCT 1 cut(s) 269
TaaI ACNGT 1 cut(s) 122
TaqI TCGA 1 cut(s) 158
TaqII GACCGA 2 cut(s) 81, 176
TasI AATT 2 cut(s) 300, 306
TfiI GAWTC 2 cut(s) 254, 324
Tru1I TTAA 2 cut(s) 225, 263
Tru9I TTAA 2 cut(s) 225, 263
TseI GCWGC 3 cut(s) 8, 67, 103
TspGWI ACGGA 2 cut(s) 35, 64
XapI RAATTY 1 cut(s) 300
XspI CTAG 1 cut(s) 328
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.