Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8337679.1

Orthogroup ID

OG0002828

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 974

Gene Structure 973 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8337679.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 973 bp

atgtttgttgagtttgtgcttgagccggtttggagtgtgtaccaggcggctttgaaggagaaggaggaggctcaagtgatggttcagaaggtgattagaacgtttaatttgactataccacctcgggatttgaagggtgacccaaaaggtatggttcaggctgtgatgagtcggtggcttcctctgcatgaggctatcttgaacatggttattaggtgtatgcctgacccgattgcagcacagtcatttcggattacaaggttacttccaaagagagaggttgtgggagatggggttgatgctaatctacttgcagaggcggagcttgtgagaagttcggtggaagcttgtgattctaggcctgaagctccttgtgttgtttttgtttcgaaaatgtttgctgtgccaacgaaaacacttccaaagtatggcttggatggggagattttggataatacatctgatgaaggtgaattggatgagtgcttccttgcgtttgcaaggatctatagtggggttcttcgtcctggtgagaaaatttatgtgctttcagctttatatgatcccttaaaaggggaatcaatgcagaagcatattcaggtggctaagttgcattctctgtatctcatgatgggccaaaatttacagcatgtgccagaggcgcaggcaggggatattgtggcaatccgaggccttgggcagcatatactgaaaactgcaacactttcatcaacaaagaactgttggcctttctccagtatgtcattccaggtttctcccactctgaaagttgcaattgagccatctgatcctgcagatatgggtgcattgatgaagggtttacggctgctgaacagggcagacccttttgtagaggtcacggtttctgctagaggagaacatgttctgtctgctgcaggagaagtacatcttgaaagatgcataaaagatttgaaggatagatttgcaaggg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03008 map03008

Pfam Domains

Protein Families

EFG_C EFG_II GTP_EFTU GTP_EFTU_D2

Protein Analysis

324

Amino Acids

35.93

Weight (kDa)

6.2

Isoelectric Point (pI)

41.58

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002828)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G22980 AT3G22980 AT3G22980
fragaria_vesca	FvH4_3g14510 FvH4_4g04790 FvH4_4g04800 FvH4_4g04801 FvH4_5g27362 FvH4_6g08980
malus_domestica	MD10G1213300.v1.1
prunus_persica	Prupe.4G129900_v2.0.a1
pyrus_communis	pycom05g21320 pycom05g21330 pycom05g23810 pycom10g18000
rosa_chinensis	RchiOBHm_Chr6g0274771
rosa_laevigata	RLG00000018664 RLG00000032745
rosa_multiflora	Rmu_co8270721.1_g000001 Rmu_co8337679.1_g000001 Rmu_sc0001938.1_g000004 Rmu_sc0006223.1_g000002 Rmu_sc0014273.1_g000001 Rmu_ssc0000027.1_g000001
rosa_roxburghii	Rroxscaffold_1G00055330 Rroxscaffold_2G00121910 Rroxscaffold_2G00121920 Rroxscaffold_7G00193950
rosa_rugosa	Rorug06G0084300
rosa_samantha	Rh2AG294600 Rh2DG318500 Rh2DG318700 Rh5DG169500 Rh6AG200200 Rh6BG203700 Rh6CG203900 Rh6DG195300
rosa_wichuraiana	Rw5G015390 Rw6G017390

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	428
AciI	CCGC	2 cut(s)	47, 320
AclI	AACGTT	1 cut(s)	101
AclWI	GGATC	3 cut(s)	512, 557, 803
AcsI	RAATTY	2 cut(s)	537, 640
AcuI	CTGAAG	1 cut(s)	384
AfaI	GTAC	2 cut(s)	41, 927
AfiI	CCNNNNNNNGG	3 cut(s)	428, 572, 573
AflIII	ACRYGT	1 cut(s)	901
AgsI	TTSAA	5 cut(s)	55, 133, 202, 935, 955
AjnI	CCWGG	3 cut(s)	42, 526, 768
AloI	GAACNNNNNNTCC	2 cut(s)	888, 920
AluBI	AGCT	4 cut(s)	325, 347, 368, 554
AluI	AGCT	4 cut(s)	325, 347, 368, 554
AlwI	GGATC	3 cut(s)	512, 557, 803
Ama87I	CYCGRG	1 cut(s)	123
AoxI	GGCC	4 cut(s)	359, 634, 691, 746
ApeKI	GCWGC	4 cut(s)	236, 700, 847, 914
ApoI	RAATTY	2 cut(s)	537, 640
Asp700I	GAANNNNTTC	1 cut(s)	903
AspLEI	GCGC	1 cut(s)	664
AspS9I	GGNCC	1 cut(s)	634
AsuHPI	GGTGA	4 cut(s)	103, 149, 482, 542
AsuII	TTCGAA	1 cut(s)	389
AvaI	CYCGRG	1 cut(s)	123
BbvI	GCAGC	4 cut(s)	248, 712, 834, 901
BccI	CCATC	5 cut(s)	73, 284, 431, 625, 811
BceAI	ACGGC	1 cut(s)	860
BciT130I	CCWGG	3 cut(s)	44, 528, 770
BfaI	CTAG	2 cut(s)	357, 891
BfmI	CTRYAG	3 cut(s)	508, 813, 915
BisI	GCNGC	5 cut(s)	48, 237, 701, 848, 915
BlsI	GCNGC	5 cut(s)	49, 238, 702, 849, 916
Bme1390I	CCNGG	3 cut(s)	44, 528, 770
BmeT110I	CYCGRG	1 cut(s)	123
BmgT120I	GGNCC	1 cut(s)	634
BmrFI	CCNGG	3 cut(s)	44, 528, 770
BmsI	GCATC	2 cut(s)	289, 929
BpmI	CTGGAG	1 cut(s)	739
Bpu14I	TTCGAA	1 cut(s)	389
BpuEI	CTTGAG	2 cut(s)	41, 57
BsaBI	GATNNNNATC	1 cut(s)	303
BsaJI	CCNNGG	3 cut(s)	122, 688, 694
BsaXI	ACNNNNNCTCC	4 cut(s)	279, 309, 888, 918
Bsc4I	CCNNNNNNNGG	3 cut(s)	428, 572, 573
Bse118I	RCCGGY	1 cut(s)	25
Bse1I	ACTGG	1 cut(s)	756
Bse8I	GATNNNNATC	1 cut(s)	303
BseBI	CCWGG	3 cut(s)	44, 528, 770
BseDI	CCNNGG	3 cut(s)	122, 688, 694
BseGI	GGATG	2 cut(s)	442, 484
BseJI	GATNNNNATC	1 cut(s)	303
BseLI	CCNNNNNNNGG	3 cut(s)	428, 572, 573
BseNI	ACTGG	1 cut(s)	756
BseRI	GAGGAG	2 cut(s)	80, 909
BseXI	GCAGC	4 cut(s)	248, 712, 834, 901
BshFI	GGCC	4 cut(s)	361, 636, 693, 748
BsiHKCI	CYCGRG	1 cut(s)	123
BsiSI	CCGG	1 cut(s)	26
BslI	CCNNNNNNNGG	3 cut(s)	428, 572, 573
BsmI	GAATGC	1 cut(s)	613
BsnI	GGCC	4 cut(s)	361, 636, 693, 748
BsoBI	CYCGRG	1 cut(s)	123
Bsp119I	TTCGAA	1 cut(s)	389
Bsp143I	GATC	3 cut(s)	504, 562, 808
BspACI	CCGC	2 cut(s)	47, 320
BspANI	GGCC	4 cut(s)	361, 636, 693, 748
BspHI	TCATGA	1 cut(s)	627
BspMAI	CTGCAG	2 cut(s)	817, 919
BspPI	GGATC	3 cut(s)	512, 557, 803
BspT104I	TTCGAA	1 cut(s)	389
BsrFI	RCCGGY	1 cut(s)	25
BsrI	ACTGG	1 cut(s)	756
BssAI	RCCGGY	1 cut(s)	25
BssECI	CCNNGG	3 cut(s)	122, 688, 694
BssMI	GATC	3 cut(s)	504, 562, 808
BssT1I	CCWWGG	1 cut(s)	694
Bst2UI	CCWGG	3 cut(s)	44, 528, 770
Bst4CI	ACNGT	3 cut(s)	243, 743, 883
BstBI	TTCGAA	1 cut(s)	389
BstC8I	GCNNGC	1 cut(s)	666
BstDEI	CTNAG	1 cut(s)	606
BstEII	GGTNACC	1 cut(s)	137
BstF5I	GGATG	2 cut(s)	442, 484
BstHHI	GCGC	1 cut(s)	664
BstKTI	GATC	3 cut(s)	507, 565, 811
BstMBI	GATC	3 cut(s)	504, 562, 808
BstMWI	GCNNNNNNNGC	2 cut(s)	184, 661
BstNI	CCWGG	3 cut(s)	44, 528, 770
BstNSI	RCATGY	2 cut(s)	653, 905
BstPI	GGTNACC	1 cut(s)	137
BstSCI	CCNGG	3 cut(s)	42, 526, 768
BstSFI	CTRYAG	3 cut(s)	508, 813, 915
BstV1I	GCAGC	4 cut(s)	248, 712, 834, 901
BstX2I	RGATCY	1 cut(s)	504
BstYI	RGATCY	1 cut(s)	504
BsuRI	GGCC	4 cut(s)	361, 636, 693, 748
BtsCI	GGATG	2 cut(s)	442, 484
Cac8I	GCNNGC	1 cut(s)	666
CciI	TCATGA	1 cut(s)	627
CfoI	GCGC	1 cut(s)	664
Cfr10I	RCCGGY	1 cut(s)	25
Cfr13I	GGNCC	1 cut(s)	634
Csp6I	GTAC	2 cut(s)	40, 926
CviAII	CATG	5 cut(s)	188, 205, 628, 650, 902
CviQI	GTAC	2 cut(s)	40, 926
DdeI	CTNAG	1 cut(s)	606
DpnI	GATC	3 cut(s)	506, 564, 810
DpnII	GATC	3 cut(s)	504, 562, 808
EciI	GGCGGA	1 cut(s)	335
Eco130I	CCWWGG	1 cut(s)	694
Eco147I	AGGCCT	2 cut(s)	361, 693
Eco57I	CTGAAG	1 cut(s)	384
Eco88I	CYCGRG	1 cut(s)	123
Eco91I	GGTNACC	1 cut(s)	137
EcoO65I	GGTNACC	1 cut(s)	137
EcoRII	CCWGG	3 cut(s)	42, 526, 768
EcoT14I	CCWWGG	1 cut(s)	694
EcoT22I	ATGCAT	1 cut(s)	944
ErhI	CCWWGG	1 cut(s)	694
FaeI	CATG	5 cut(s)	191, 208, 631, 653, 905
FalI	AAGNNNNNCTT	4 cut(s)	416, 448, 915, 947
FatI	CATG	5 cut(s)	187, 204, 627, 649, 901
Fnu4HI	GCNGC	5 cut(s)	48, 237, 701, 848, 915
FokI	GGATG	2 cut(s)	449, 491
Fsp4HI	GCNGC	5 cut(s)	48, 237, 701, 848, 915
FspBI	CTAG	2 cut(s)	357, 891
GlaI	GCGC	1 cut(s)	663
GluI	GCNGC	5 cut(s)	48, 237, 701, 848, 915
GsuI	CTGGAG	1 cut(s)	739
HaeIII	GGCC	4 cut(s)	361, 636, 693, 748
HapII	CCGG	1 cut(s)	26
HhaI	GCGC	1 cut(s)	664
Hin1II	CATG	5 cut(s)	191, 208, 631, 653, 905
Hin6I	GCGC	1 cut(s)	662
HinP1I	GCGC	1 cut(s)	662
HindIII	AAGCTT	1 cut(s)	345
HinfI	GANTC	3 cut(s)	169, 353, 578
HpaII	CCGG	1 cut(s)	26
HphI	GGTGA	4 cut(s)	103, 149, 482, 542
Hpy166II	GTNNAC	2 cut(s)	40, 842
Hpy188I	TCNGA	6 cut(s)	87, 252, 463, 689, 786, 808
Hpy188III	TCNNGA	4 cut(s)	125, 199, 628, 932
Hpy8I	GTNNAC	2 cut(s)	40, 842
HpyAV	CCTTC	7 cut(s)	49, 55, 82, 127, 461, 829, 949
HpyCH4III	ACNGT	3 cut(s)	243, 743, 883
HpyCH4IV	ACGT	1 cut(s)	101
HpyF10VI	GCNNNNNNNGC	2 cut(s)	184, 661
HpyF3I	CTNAG	1 cut(s)	606
HpySE526I	ACGT	1 cut(s)	101
Hsp92II	CATG	5 cut(s)	191, 208, 631, 653, 905
HspAI	GCGC	1 cut(s)	662
Kzo9I	GATC	3 cut(s)	504, 562, 808
LmnI	GCTCC	2 cut(s)	322, 373
Lsp1109I	GCAGC	4 cut(s)	248, 712, 834, 901
LweI	GCATC	2 cut(s)	289, 929
MaeI	CTAG	2 cut(s)	357, 891
MaeII	ACGT	1 cut(s)	101
MaeIII	GTNAC	3 cut(s)	137, 261, 877
MalI	GATC	3 cut(s)	506, 564, 810
MboI	GATC	3 cut(s)	504, 562, 808
MboII	GAAGA	1 cut(s)	512
MfeI	CAATTG	1 cut(s)	795
MflI	RGATCY	1 cut(s)	504
MluCI	AATT	5 cut(s)	106, 473, 537, 640, 795
MlyI	GAGTC	1 cut(s)	178
Mph1103I	ATGCAT	1 cut(s)	944
MroXI	GAANNNNTTC	1 cut(s)	903
MseI	TTAA	2 cut(s)	105, 569
MspI	CCGG	1 cut(s)	26
MspR9I	CCNGG	3 cut(s)	44, 528, 770
MunI	CAATTG	1 cut(s)	795
Mva1269I	GAATGC	1 cut(s)	613
MvaI	CCWGG	3 cut(s)	44, 528, 770
MwoI	GCNNNNNNNGC	2 cut(s)	184, 661
NdeII	GATC	3 cut(s)	504, 562, 808
NlaIII	CATG	5 cut(s)	191, 208, 631, 653, 905
NmuCI	GTSAC	2 cut(s)	137, 877
NsiI	ATGCAT	1 cut(s)	944
NspI	RCATGY	2 cut(s)	653, 905
NspV	TTCGAA	1 cut(s)	389
PagI	TCATGA	1 cut(s)	627
PceI	AGGCCT	2 cut(s)	361, 693
PciI	ACATGT	1 cut(s)	901
PctI	GAATGC	1 cut(s)	613
PdmI	GAANNNNTTC	1 cut(s)	903
PfeI	GAWTC	2 cut(s)	353, 578
PflMI	CCANNNNNTGG	1 cut(s)	428
PkrI	GCNGC	5 cut(s)	49, 238, 702, 849, 916
PleI	GAGTC	1 cut(s)	177
PpsI	GAGTC	1 cut(s)	177
PscI	ACATGT	1 cut(s)	901
Psp1406I	AACGTT	1 cut(s)	101
Psp6I	CCWGG	3 cut(s)	42, 526, 768
PspEI	GGTNACC	1 cut(s)	137
PspGI	CCWGG	3 cut(s)	42, 526, 768
PspPI	GGNCC	1 cut(s)	634
PstI	CTGCAG	2 cut(s)	817, 919
PsuI	RGATCY	1 cut(s)	504
RsaI	GTAC	2 cut(s)	41, 927
RsaNI	GTAC	2 cut(s)	40, 926
SaqAI	TTAA	2 cut(s)	105, 569
SatI	GCNGC	5 cut(s)	48, 237, 701, 848, 915
Sau3AI	GATC	3 cut(s)	504, 562, 808
Sau96I	GGNCC	1 cut(s)	634
SchI	GAGTC	1 cut(s)	178
ScrFI	CCNGG	3 cut(s)	44, 528, 770
SfaNI	GCATC	2 cut(s)	289, 929
SfcI	CTRYAG	3 cut(s)	508, 813, 915
SfuI	TTCGAA	1 cut(s)	389
SmlI	CTYRAG	2 cut(s)	20, 72
SmoI	CTYRAG	2 cut(s)	20, 72
Sse9I	AATT	5 cut(s)	106, 473, 537, 640, 795
SseBI	AGGCCT	2 cut(s)	361, 693
SsiI	CCGC	2 cut(s)	47, 320
SspMI	CTAG	2 cut(s)	357, 891
StuI	AGGCCT	2 cut(s)	361, 693
StyD4I	CCNGG	3 cut(s)	42, 526, 768
StyI	CCWWGG	1 cut(s)	694
TaaI	ACNGT	3 cut(s)	243, 743, 883
TaiI	ACGT	1 cut(s)	104
TaqI	TCGA	1 cut(s)	389
TasI	AATT	5 cut(s)	106, 473, 537, 640, 795
TatI	WGTACW	1 cut(s)	925
TauI	GCSGC	1 cut(s)	50
TfiI	GAWTC	2 cut(s)	353, 578
Tru1I	TTAA	2 cut(s)	105, 569
Tru9I	TTAA	2 cut(s)	105, 569
TseFI	GTSAC	2 cut(s)	137, 877
TseI	GCWGC	4 cut(s)	236, 700, 847, 914
Tsp45I	GTSAC	2 cut(s)	137, 877
TspDTI	ATGAA	3 cut(s)	480, 717, 848
Van91I	CCANNNNNTGG	1 cut(s)	428
XapI	RAATTY	2 cut(s)	537, 640
XceI	RCATGY	2 cut(s)	653, 905
XmnI	GAANNNNTTC	1 cut(s)	903
XspI	CTAG	2 cut(s)	357, 891
Zsp2I	ATGCAT	1 cut(s)	944

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.