Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000066.1

Orthogroup ID

OG0005537

Physical Location & Seq

Genomic Coordinates Reverse (-)

103358 .. 103714

Gene Structure 357 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000066.1_g000023.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 357 bp

atggctgaggagaatccttcagatggagatgcaataacagagcaagaaactccaacaaatagccatccaacagtgatggtgggttccaacgaaaacagactagatacaagcaagagcaaggaggatggaactaaaacagttccactctacagacttttctcttttgctgattccatggattacctgttaatgtctgttggtacaatcagcgctattggtaatggactctgtatgcctctaatggccatagtctttggagatctacttacttcttttttagaaactgggaataacaagagtgtggctgatgcagtttccaaggtgagtcttctaggaccaaaatcagatatatattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005575 GO:0005623 GO:0005886 GO:0005911 GO:0006810 GO:0008150 GO:0009506 GO:0009914 GO:0009926 GO:0009966 GO:0010315 GO:0010329 GO:0010540 GO:0010646 GO:0010817 GO:0010928 GO:0015562 GO:0016020 GO:0022857 GO:0023051 GO:0030054 GO:0044464 GO:0048583 GO:0050789 GO:0050794 GO:0051179 GO:0051234 GO:0055044 GO:0055085 GO:0060918 GO:0065007 GO:0065008 GO:0071944 GO:0080161

KEGG Pathways

Metabolic & Signaling

ko02010 ko04976 ko05206 ko05226 map02010 map04976 map05206 map05226

Pfam Domains

Protein Families

ABC_membrane ABC_tran

Protein Analysis

118

Amino Acids

12.61

Weight (kDa)

4.35

Isoelectric Point (pI)

24.76

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005537)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g00610
malus_domestica	MD13G1139000.v1.1 MD17G1284600.v1.1
pyrus_communis	pycom16g11890
rosa_chinensis	RchiOBHm_Chr4g0427741
rosa_multiflora	Rmu_co8181678.1_g000001 Rmu_sc0000066.1_g000023 Rmu_sc0000066.1_g000038 Rmu_sc0003399.1_g000001
rosa_roxburghii	Rroxscaffold_5G00367600 Rroxscaffold_5G00369430 Rroxscaffold_5G00369490
rosa_samantha	Rh3AG272000 Rh3AG272500 Rh3DG007700 Rh3DG214800 Rh4AG272500 Rh4AG272600 Rh4AG276400 Rh4BG278200 Rh4BG278300 Rh4BG278400 Rh4BG282100 Rh4BG282300 Rh4BG282700 Rh4CG176800 Rh4CG297700 Rh4CG298200
rosa_wichuraiana	Rw4G023630

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	243
AfaI	GTAC	1 cut(s)	202
AfeI	AGCGCT	1 cut(s)	211
AfiI	CCNNNNNNNGG	1 cut(s)	23
Aor51HI	AGCGCT	1 cut(s)	211
AoxI	GGCC	1 cut(s)	243
AspLEI	GCGC	1 cut(s)	212
AspS9I	GGNCC	1 cut(s)	335
AsuHPI	GGTGA	1 cut(s)	334
AvaII	GGWCC	1 cut(s)	335
BalI	TGGCCA	1 cut(s)	245
BbsI	GAAGAC	1 cut(s)	320
BbvCI	CCTCAGC	1 cut(s)	6
BccI	CCATC	4 cut(s)	17, 70, 72, 119
BfaI	CTAG	2 cut(s)	101, 332
BfmI	CTRYAG	1 cut(s)	148
BfoI	RGCGCY	1 cut(s)	213
BglII	AGATCT	1 cut(s)	259
Bme18I	GGWCC	1 cut(s)	335
BmgT120I	GGNCC	1 cut(s)	335
BmiI	GGNNCC	1 cut(s)	85
BmrI	ACTGGG	1 cut(s)	294
BmsI	GCATC	2 cut(s)	19, 298
BmuI	ACTGGG	1 cut(s)	294
BpiI	GAAGAC	1 cut(s)	320
Bpu10I	CCTNAGC	1 cut(s)	6
BsaJI	CCNNGG	2 cut(s)	174, 318
Bsc4I	CCNNNNNNNGG	1 cut(s)	23
Bse1I	ACTGG	1 cut(s)	289
BseDI	CCNNGG	2 cut(s)	174, 318
BseGI	GGATG	2 cut(s)	64, 130
BseLI	CCNNNNNNNGG	1 cut(s)	23
BseNI	ACTGG	1 cut(s)	289
BseRI	GAGGAG	1 cut(s)	23
BshFI	GGCC	1 cut(s)	245
BslI	CCNNNNNNNGG	1 cut(s)	23
BsnI	GGCC	1 cut(s)	245
Bsp143I	GATC	1 cut(s)	259
Bsp19I	CCATGG	1 cut(s)	174
BspANI	GGCC	1 cut(s)	245
BspLI	GGNNCC	1 cut(s)	85
BsrI	ACTGG	1 cut(s)	289
BssECI	CCNNGG	2 cut(s)	174, 318
BssMI	GATC	1 cut(s)	259
BssT1I	CCWWGG	2 cut(s)	174, 318
Bst4CI	ACNGT	2 cut(s)	73, 139
BstDEI	CTNAG	1 cut(s)	6
BstDSI	CCRYGG	1 cut(s)	174
BstF5I	GGATG	2 cut(s)	64, 130
BstH2I	RGCGCY	1 cut(s)	213
BstHHI	GCGC	1 cut(s)	212
BstKTI	GATC	1 cut(s)	262
BstMBI	GATC	1 cut(s)	259
BstSFI	CTRYAG	1 cut(s)	148
BstV2I	GAAGAC	1 cut(s)	320
BstX2I	RGATCY	1 cut(s)	259
BstYI	RGATCY	1 cut(s)	259
BsuRI	GGCC	1 cut(s)	245
BtgI	CCRYGG	1 cut(s)	174
BtsCI	GGATG	2 cut(s)	64, 130
BtsIMutI	CAGTG	1 cut(s)	78
CfoI	GCGC	1 cut(s)	212
Cfr13I	GGNCC	1 cut(s)	335
Csp6I	GTAC	1 cut(s)	201
CviAII	CATG	1 cut(s)	175
CviJI	RGCY	4 cut(s)	5, 63, 245, 305
CviKI_1	RGCY	4 cut(s)	5, 63, 245, 305
CviQI	GTAC	1 cut(s)	201
DdeI	CTNAG	1 cut(s)	6
DpnI	GATC	1 cut(s)	261
DpnII	GATC	1 cut(s)	259
EaeI	YGGCCR	1 cut(s)	243
Eco130I	CCWWGG	2 cut(s)	174, 318
Eco47I	GGWCC	1 cut(s)	335
Eco47III	AGCGCT	1 cut(s)	211
EcoT14I	CCWWGG	2 cut(s)	174, 318
ErhI	CCWWGG	2 cut(s)	174, 318
FaeI	CATG	1 cut(s)	178
FaiI	YATR	5 cut(s)	176, 233, 248, 350, 352
FatI	CATG	1 cut(s)	174
FokI	GGATG	2 cut(s)	51, 137
FspBI	CTAG	2 cut(s)	101, 332
GlaI	GCGC	1 cut(s)	211
HaeII	RGCGCY	1 cut(s)	213
HaeIII	GGCC	1 cut(s)	245
HhaI	GCGC	1 cut(s)	212
Hin1II	CATG	1 cut(s)	178
Hin6I	GCGC	1 cut(s)	210
HinP1I	GCGC	1 cut(s)	210
HinfI	GANTC	4 cut(s)	13, 170, 225, 325
HphI	GGTGA	1 cut(s)	334
Hpy188I	TCNGA	2 cut(s)	22, 346
HpyAV	CCTTC	1 cut(s)	27
HpyCH4III	ACNGT	2 cut(s)	73, 139
HpyCH4V	TGCA	2 cut(s)	32, 311
HpyF3I	CTNAG	1 cut(s)	6
Hsp92II	CATG	1 cut(s)	178
HspAI	GCGC	1 cut(s)	210
Kzo9I	GATC	1 cut(s)	259
LpnPI	CCDG	2 cut(s)	197, 270
LweI	GCATC	2 cut(s)	19, 298
MaeI	CTAG	2 cut(s)	101, 332
MalI	GATC	1 cut(s)	261
MboI	GATC	1 cut(s)	259
MboII	GAAGA	1 cut(s)	320
MflI	RGATCY	1 cut(s)	259
MlsI	TGGCCA	1 cut(s)	245
MluNI	TGGCCA	1 cut(s)	245
MlyI	GAGTC	2 cut(s)	219, 334
MmeI	TCCRAC	3 cut(s)	77, 92, 111
MnlI	CCTC	2 cut(s)	115, 246
Mox20I	TGGCCA	1 cut(s)	245
MscI	TGGCCA	1 cut(s)	245
MseI	TTAA	1 cut(s)	188
Msp20I	TGGCCA	1 cut(s)	245
NcoI	CCATGG	1 cut(s)	174
NdeII	GATC	1 cut(s)	259
NlaIII	CATG	1 cut(s)	178
NlaIV	GGNNCC	1 cut(s)	85
PfeI	GAWTC	2 cut(s)	13, 170
PleI	GAGTC	2 cut(s)	219, 333
PpsI	GAGTC	2 cut(s)	219, 333
PspN4I	GGNNCC	1 cut(s)	85
PspPI	GGNCC	1 cut(s)	335
PsuI	RGATCY	1 cut(s)	259
RsaI	GTAC	1 cut(s)	202
RsaNI	GTAC	1 cut(s)	201
SaqAI	TTAA	1 cut(s)	188
Sau3AI	GATC	1 cut(s)	259
Sau96I	GGNCC	1 cut(s)	335
SchI	GAGTC	2 cut(s)	219, 334
SetI	ASST	2 cut(s)	186, 324
SfaNI	GCATC	2 cut(s)	19, 298
SfcI	CTRYAG	1 cut(s)	148
SinI	GGWCC	1 cut(s)	335
SspMI	CTAG	2 cut(s)	101, 332
StyI	CCWWGG	2 cut(s)	174, 318
TaaI	ACNGT	2 cut(s)	73, 139
TfiI	GAWTC	2 cut(s)	13, 170
Tru1I	TTAA	1 cut(s)	188
Tru9I	TTAA	1 cut(s)	188
TscAI	CASTG	1 cut(s)	78
TspRI	CASTG	1 cut(s)	78
VpaK11BI	GGWCC	1 cut(s)	335
XspI	CTAG	2 cut(s)	101, 332

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.