Rmu_sc0000112.1_g000024

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000112.1
Physical Location & Seq
Reverse (-)
111182 .. 111526
345 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000112.1_g000024.1.cds

Sequence Viewer

Length: 345 bp
atgcaccgccataaactcgctcagggaagcatacatgctgatttggctttggagaattcactgcttgatatgtattgtaactctggcgacacccaagcagcttttagtgtgtttaataaaatggacagcccggatttggtttcatggaacacaatgattgctgggtattcagaaaatgaggatggggaaaaggcgatgaatttgtttgcccggttgaaaagattgtgttttcttaaaccagatgaacatacttatgcagctatcatatctgcagcaggtacataccttgcttctgactatggtaagcttcttcatggtcaagtcataaaagtaggactcgagtag

Protein Analysis

114

Amino Acids

12.6

Weight (kDa)

5.66

Isoelectric Point (pI)

24.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 266
AciI CCGC 1 cut(s) 7
AcsI RAATTY 2 cut(s) 55, 199
AfaI GTAC 1 cut(s) 280
AfiI CCNNNNNNNGG 1 cut(s) 136
AgsI TTSAA 1 cut(s) 217
AluBI AGCT 3 cut(s) 101, 260, 307
AluI AGCT 3 cut(s) 101, 260, 307
Ama87I CYCGRG 1 cut(s) 338
ApeKI GCWGC 3 cut(s) 98, 257, 272
ApoI RAATTY 2 cut(s) 55, 199
AsuC2I CCSGG 2 cut(s) 131, 211
AvaI CYCGRG 1 cut(s) 338
BbvI GCAGC 3 cut(s) 110, 269, 284
BccI CCATC 1 cut(s) 176
BcnI CCSGG 2 cut(s) 131, 211
BfmI CTRYAG 1 cut(s) 270
BfuAI ACCTGC 1 cut(s) 266
BisI GCNGC 3 cut(s) 99, 258, 273
BlsI GCNGC 3 cut(s) 100, 259, 274
Bme1390I CCNGG 2 cut(s) 131, 211
BmeT110I CYCGRG 1 cut(s) 338
BmrFI CCNGG 2 cut(s) 131, 211
Bpu10I CCTNAGC 1 cut(s) 21
BpuMI CCSGG 2 cut(s) 131, 211
Bsc4I CCNNNNNNNGG 1 cut(s) 136
BseGI GGATG 1 cut(s) 187
BseLI CCNNNNNNNGG 1 cut(s) 136
BseMII CTCAG 1 cut(s) 35
BseXI GCAGC 3 cut(s) 110, 269, 284
BseYI CCCAGC 1 cut(s) 161
BsiHKCI CYCGRG 1 cut(s) 338
BsiSI CCGG 2 cut(s) 131, 211
BslI CCNNNNNNNGG 1 cut(s) 136
BsoBI CYCGRG 1 cut(s) 338
BspACI CCGC 1 cut(s) 7
BspCNI CTCAG 1 cut(s) 34
BspMAI CTGCAG 1 cut(s) 274
BspMI ACCTGC 1 cut(s) 266
BstDEI CTNAG 1 cut(s) 21
BstF5I GGATG 1 cut(s) 187
BstMWI GCNNNNNNNGC 1 cut(s) 44
BstNSI RCATGY 1 cut(s) 38
BstSCI CCNGG 2 cut(s) 129, 209
BstSFI CTRYAG 1 cut(s) 270
BstV1I GCAGC 3 cut(s) 110, 269, 284
BtgZI GCGATG 1 cut(s) 209
BtsCI GGATG 1 cut(s) 187
BtsI GCAGTG 1 cut(s) 59
BtsIMutI CAGTG 1 cut(s) 59
BveI ACCTGC 1 cut(s) 266
Csp6I GTAC 1 cut(s) 279
CviAII CATG 3 cut(s) 35, 144, 314
CviJI RGCY 5 cut(s) 47, 101, 129, 260, 307
CviKI_1 RGCY 5 cut(s) 47, 101, 129, 260, 307
CviQI GTAC 1 cut(s) 279
DdeI CTNAG 1 cut(s) 21
Eco88I CYCGRG 1 cut(s) 338
EcoRI GAATTC 1 cut(s) 55
FaeI CATG 3 cut(s) 38, 147, 317
FatI CATG 3 cut(s) 34, 143, 313
Fnu4HI GCNGC 3 cut(s) 99, 258, 273
FokI GGATG 1 cut(s) 194
Fsp4HI GCNGC 3 cut(s) 99, 258, 273
GluI GCNGC 3 cut(s) 99, 258, 273
GsaI CCCAGC 1 cut(s) 165
HapII CCGG 2 cut(s) 131, 211
Hin1II CATG 3 cut(s) 38, 147, 317
HindIII AAGCTT 1 cut(s) 305
HinfI GANTC 1 cut(s) 336
HpaII CCGG 2 cut(s) 131, 211
Hpy188I TCNGA 2 cut(s) 172, 295
HpyCH4V TGCA 3 cut(s) 4, 257, 272
HpyF10VI GCNNNNNNNGC 1 cut(s) 44
HpyF3I CTNAG 1 cut(s) 21
Hsp92II CATG 3 cut(s) 38, 147, 317
LpnPI CCDG 7 cut(s) 8, 69, 144, 147, 224, 252, 261
Lsp1109I GCAGC 3 cut(s) 110, 269, 284
MaeIII GTNAC 1 cut(s) 77
MboII GAAGA 1 cut(s) 302
MluCI AATT 2 cut(s) 55, 199
MlyI GAGTC 1 cut(s) 330
MnlI CCTC 1 cut(s) 172
MseI TTAA 2 cut(s) 114, 234
MslI CAYNNNNRTG 1 cut(s) 252
MspI CCGG 2 cut(s) 131, 211
MspR9I CCNGG 2 cut(s) 131, 211
MwoI GCNNNNNNNGC 1 cut(s) 44
NciI CCSGG 2 cut(s) 131, 211
NlaIII CATG 3 cut(s) 38, 147, 317
NspI RCATGY 1 cut(s) 38
PaeR7I CTCGAG 1 cut(s) 338
PkrI GCNGC 3 cut(s) 100, 259, 274
PleI GAGTC 1 cut(s) 330
PpsI GAGTC 1 cut(s) 330
PspFI CCCAGC 1 cut(s) 161
PspXI VCTCGAGB 1 cut(s) 338
PstI CTGCAG 1 cut(s) 274
RsaI GTAC 1 cut(s) 280
RsaNI GTAC 1 cut(s) 279
RseI CAYNNNNRTG 1 cut(s) 252
SaqAI TTAA 2 cut(s) 114, 234
SatI GCNGC 3 cut(s) 99, 258, 273
SchI GAGTC 1 cut(s) 330
ScrFI CCNGG 2 cut(s) 131, 211
SetI ASST 5 cut(s) 103, 262, 280, 288, 309
SfcI CTRYAG 1 cut(s) 270
Sfr274I CTCGAG 1 cut(s) 338
SlaI CTCGAG 1 cut(s) 338
SmiMI CAYNNNNRTG 1 cut(s) 252
SmlI CTYRAG 1 cut(s) 338
SmoI CTYRAG 1 cut(s) 338
Sse9I AATT 2 cut(s) 55, 199
SsiI CCGC 1 cut(s) 7
StyD4I CCNGG 2 cut(s) 129, 209
TaqI TCGA 1 cut(s) 339
TasI AATT 2 cut(s) 55, 199
Tru1I TTAA 2 cut(s) 114, 234
Tru9I TTAA 2 cut(s) 114, 234
TscAI CASTG 1 cut(s) 66
TseI GCWGC 3 cut(s) 98, 257, 272
TspDTI ATGAA 4 cut(s) 132, 212, 258, 302
TspRI CASTG 1 cut(s) 66
XapI RAATTY 2 cut(s) 55, 199
XceI RCATGY 1 cut(s) 38
XhoI CTCGAG 1 cut(s) 338
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.