Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000382.1

Orthogroup ID

OG0003521

Physical Location & Seq

Genomic Coordinates Forward (+)

57566 .. 59276

Gene Structure 1711 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000382.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 825 bp

atggaccaccaccacgactacagccagagcagcagccaccaccaccaccacagccagagcagcagccaccaccaccatcaccaccggcacaagtcccactccgacggcaacctcttctctctctgtccgttctggcagtcagggtcccaaacgtcgtcgtcttcctcttcgactcagatcctacagagcggcgtcgacggatcgaagtcgaagcccaaaacggtgtcgtccgtcgcgagatcgctgctcccgccccggcgccggctccggctcgaccctgccagcaaactctacttcccctatgaacctgggaaacaagtgaagagcgcgattcggttgcagaacagtagcaagtctcatgtagctttcaagtttcaaactactgcaccgaaaagctgttacatgcgtcctccgggtggtattcttgctccaggagagagcataattgctactgtgtttaggtttgtggaacaacctgacagcaatgagaaaaatgtggatcagaaggccaaggttaagttcaaaattatgagtctgaaggtgaaagctgaaacggactatgctcctgagctgtttgatgagcaaaaggatcaagtagcagttgagcgaattttgcgggttgtatttttagatgcagagcaccctactcctgctctagaaaaactgaagaggcagttggctgaagctgaggctgcacttgaagtgcgtaagaaacctcccgcagattcaggtcctcgtgatgttggggaaggccttgtaatagatgaatggaaggagcgaagggagaaatacctggctcggcaacaggttgaagcagtaggttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0006950 GO:0006970 GO:0008150 GO:0009628 GO:0016020 GO:0044464 GO:0050896 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Motile_Sperm

Protein Analysis

274

Amino Acids

30.85

Weight (kDa)

9.44

Isoelectric Point (pI)

56.23

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003521)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G54110 AT5G54110
fragaria_vesca	FvH4_3g21120 FvH4_6g44480 FvH4_6g44480
malus_domestica	MD03G1217600.v1.1 MD09G1096700.v1.1 MD11G1235400.v1.1 MD17G1085000.v1.1
prunus_persica	Prupe.3G230200_v2.0.a1 Prupe.4G191600_v2.0.a1
pyrus_communis	pycom03g16720 pycom09g02110 pycom11g20710 pycom17g08230
rosa_chinensis	RchiOBHm_Chr2g0161541 RchiOBHm_Chr5g0036131
rosa_laevigata	RLG00000021290 RLG00000033673
rosa_multiflora	Rmu_sc0000382.1_g000010 Rmu_sc0013623.1_g000001
rosa_roxburghii	Rroxscaffold_1G00044610 Rroxscaffold_2G00088720
rosa_rugosa	Rorug02G0490400 Rorug05G0152700
rosa_samantha	Rh2AG556700 Rh2BG570000 Rh2CG540500 Rh2DG579400 Rh5AG247300 Rh5BG247700 Rh5CG278700 Rh5DG256100
rosa_wichuraiana	Rw2G046070 Rw5G022680

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	258
AccBSI	CCGCTC	1 cut(s)	189
AccI	GTMKAC	1 cut(s)	195
AccII	CGCG	2 cut(s)	236, 329
AciI	CCGC	4 cut(s)	189, 251, 616, 720
AclWI	GGATC	4 cut(s)	172, 208, 507, 597
AcsI	RAATTY	1 cut(s)	609
AcuI	CTGAAG	3 cut(s)	557, 686, 702
AcyI	GRCGYC	2 cut(s)	192, 259
AfiI	CCNNNNNNNGG	2 cut(s)	261, 416
AgsI	TTSAA	5 cut(s)	370, 377, 523, 701, 812
AjnI	CCWGG	3 cut(s)	307, 430, 792
AjuI	GAANNNNNNNTTGG	4 cut(s)	503, 535, 659, 691
AluBI	AGCT	5 cut(s)	365, 396, 548, 571, 686
AluI	AGCT	5 cut(s)	365, 396, 548, 571, 686
Alw21I	GWGCWC	1 cut(s)	642
Alw26I	GTCTC	1 cut(s)	360
AlwI	GGATC	4 cut(s)	172, 208, 507, 597
AoxI	GGCC	2 cut(s)	507, 751
ApeKI	GCWGC	6 cut(s)	30, 33, 60, 63, 244, 692
ApoI	RAATTY	1 cut(s)	609
AspLEI	GCGC	2 cut(s)	261, 329
AspS9I	GGNCC	3 cut(s)	4, 144, 731
AsuC2I	CCSGG	2 cut(s)	256, 414
AsuHPI	GGTGA	2 cut(s)	71, 553
AvaII	GGWCC	3 cut(s)	4, 144, 731
BanI	GGYRCC	1 cut(s)	258
BauI	CACGAG	1 cut(s)	735
BbsI	GAAGAC	1 cut(s)	153
Bbv12I	GWGCWC	1 cut(s)	642
BbvCI	CCTCAGC	1 cut(s)	687
BbvI	GCAGC	6 cut(s)	42, 45, 72, 75, 231, 679
BccI	CCATC	1 cut(s)	84
BceAI	ACGGC	1 cut(s)	121
BcgI	CGANNNNNNTGC	4 cut(s)	226, 260, 319, 353
BciT130I	CCWGG	3 cut(s)	309, 432, 794
BcnI	CCSGG	2 cut(s)	256, 414
BcoDI	GTCTC	1 cut(s)	360
BfaI	CTAG	1 cut(s)	656
BfmI	CTRYAG	2 cut(s)	19, 182
BfoI	RGCGCY	1 cut(s)	262
BisI	GCNGC	7 cut(s)	31, 34, 61, 64, 190, 245, 693
BlsI	GCNGC	7 cut(s)	32, 35, 62, 65, 191, 246, 694
Bme1390I	CCNGG	5 cut(s)	256, 309, 414, 432, 794
Bme18I	GGWCC	3 cut(s)	4, 144, 731
BmgT120I	GGNCC	3 cut(s)	4, 144, 731
BmiI	GGNNCC	4 cut(s)	145, 146, 260, 266
BmrFI	CCNGG	5 cut(s)	256, 309, 414, 432, 794
BmsI	GCATC	1 cut(s)	622
BpiI	GAAGAC	1 cut(s)	153
BpmI	CTGGAG	1 cut(s)	414
Bpu10I	CCTNAGC	2 cut(s)	567, 687
BpuMI	CCSGG	2 cut(s)	256, 414
BsaHI	GRCGYC	2 cut(s)	192, 259
BsaJI	CCNNGG	3 cut(s)	254, 308, 510
Bsc4I	CCNNNNNNNGG	2 cut(s)	261, 416
Bse118I	RCCGGY	2 cut(s)	84, 261
Bse3DI	GCAATG	1 cut(s)	490
BseBI	CCWGG	3 cut(s)	309, 432, 794
BseDI	CCNNGG	3 cut(s)	254, 308, 510
BseLI	CCNNNNNNNGG	2 cut(s)	261, 416
BseMI	GCAATG	1 cut(s)	490
BseMII	CTCAG	3 cut(s)	188, 558, 678
BseXI	GCAGC	6 cut(s)	42, 45, 72, 75, 231, 679
BsgI	GTGCAG	2 cut(s)	369, 678
Bsh1236I	CGCG	2 cut(s)	236, 329
BshFI	GGCC	2 cut(s)	509, 753
BshNI	GGYRCC	1 cut(s)	258
BsiHKAI	GWGCWC	1 cut(s)	642
BsiSI	CCGG	5 cut(s)	85, 256, 262, 268, 413
BslFI	GGGAC	2 cut(s)	79, 130
BslI	CCNNNNNNNGG	2 cut(s)	261, 416
BsmAI	GTCTC	1 cut(s)	360
BsmFI	GGGAC	2 cut(s)	79, 130
BsnI	GGCC	2 cut(s)	509, 753
Bsp1286I	GDGCHC	1 cut(s)	642
Bsp143I	GATC	5 cut(s)	177, 200, 239, 499, 589
Bsp68I	TCGCGA	1 cut(s)	236
BspACI	CCGC	4 cut(s)	189, 251, 616, 720
BspANI	GGCC	2 cut(s)	509, 753
BspCNI	CTCAG	3 cut(s)	187, 559, 679
BspFNI	CGCG	2 cut(s)	236, 329
BspLI	GGNNCC	4 cut(s)	145, 146, 260, 266
BspPI	GGATC	4 cut(s)	172, 208, 507, 597
BspQI	GCTCTTC	1 cut(s)	317
BspT107I	GGYRCC	1 cut(s)	258
BsrBI	CCGCTC	1 cut(s)	189
BsrDI	GCAATG	1 cut(s)	490
BsrFI	RCCGGY	2 cut(s)	84, 261
BssAI	RCCGGY	2 cut(s)	84, 261
BssECI	CCNNGG	3 cut(s)	254, 308, 510
BssMI	GATC	5 cut(s)	177, 200, 239, 499, 589
BssNI	GRCGYC	2 cut(s)	192, 259
BssSI	CACGAG	1 cut(s)	735
BssT1I	CCWWGG	1 cut(s)	510
Bst2BI	CACGAG	1 cut(s)	735
Bst2UI	CCWGG	3 cut(s)	309, 432, 794
Bst4CI	ACNGT	3 cut(s)	223, 347, 454
Bst6I	CTCTTC	4 cut(s)	119, 172, 317, 662
BstACI	GRCGYC	2 cut(s)	192, 259
BstC8I	GCNNGC	2 cut(s)	263, 283
BstDEI	CTNAG	3 cut(s)	174, 567, 687
BstFNI	CGCG	2 cut(s)	236, 329
BstH2I	RGCGCY	1 cut(s)	262
BstHHI	GCGC	2 cut(s)	261, 329
BstKTI	GATC	5 cut(s)	180, 203, 242, 502, 592
BstMAI	GTCTC	1 cut(s)	360
BstMBI	GATC	5 cut(s)	177, 200, 239, 499, 589
BstMWI	GCNNNNNNNGC	5 cut(s)	30, 60, 250, 613, 692
BstNI	CCWGG	3 cut(s)	309, 432, 794
BstNSI	RCATGY	1 cut(s)	406
BstSCI	CCNGG	5 cut(s)	254, 307, 412, 430, 792
BstSFI	CTRYAG	2 cut(s)	19, 182
BstUI	CGCG	2 cut(s)	236, 329
BstV1I	GCAGC	6 cut(s)	42, 45, 72, 75, 231, 679
BstV2I	GAAGAC	1 cut(s)	153
BstX2I	RGATCY	1 cut(s)	177
BstYI	RGATCY	1 cut(s)	177
BsuRI	GGCC	2 cut(s)	509, 753
BtuMI	TCGCGA	1 cut(s)	236
Cac8I	GCNNGC	2 cut(s)	263, 283
CfoI	GCGC	2 cut(s)	261, 329
Cfr10I	RCCGGY	2 cut(s)	84, 261
Cfr13I	GGNCC	3 cut(s)	4, 144, 731
CseI	GACGC	2 cut(s)	181, 395
CviAII	CATG	2 cut(s)	359, 403
DdeI	CTNAG	3 cut(s)	174, 567, 687
DinI	GGCGCC	1 cut(s)	260
DpnI	GATC	5 cut(s)	179, 202, 241, 501, 591
DpnII	GATC	5 cut(s)	177, 200, 239, 499, 589
Eam1104I	CTCTTC	4 cut(s)	119, 172, 317, 662
EarI	CTCTTC	4 cut(s)	119, 172, 317, 662
Eco130I	CCWWGG	1 cut(s)	510
Eco147I	AGGCCT	1 cut(s)	753
Eco47I	GGWCC	3 cut(s)	4, 144, 731
Eco57I	CTGAAG	3 cut(s)	557, 686, 702
EcoO109I	RGGNCCY	2 cut(s)	144, 731
EcoRII	CCWGG	3 cut(s)	307, 430, 792
EcoT14I	CCWWGG	1 cut(s)	510
EgeI	GGCGCC	1 cut(s)	260
EheI	GGCGCC	1 cut(s)	260
ErhI	CCWWGG	1 cut(s)	510
FaeI	CATG	2 cut(s)	362, 406
FaiI	YATR	6 cut(s)	303, 360, 404, 443, 530, 561
FaqI	GGGAC	2 cut(s)	79, 130
FatI	CATG	2 cut(s)	358, 402
FauI	CCCGC	3 cut(s)	258, 609, 727
FblI	GTMKAC	1 cut(s)	195
Fnu4HI	GCNGC	7 cut(s)	31, 34, 61, 64, 190, 245, 693
Fsp4HI	GCNGC	7 cut(s)	31, 34, 61, 64, 190, 245, 693
FspBI	CTAG	1 cut(s)	656
GlaI	GCGC	2 cut(s)	260, 328
GluI	GCNGC	7 cut(s)	31, 34, 61, 64, 190, 245, 693
GsuI	CTGGAG	1 cut(s)	414
HaeII	RGCGCY	1 cut(s)	262
HaeIII	GGCC	2 cut(s)	509, 753
HapII	CCGG	5 cut(s)	85, 256, 262, 268, 413
HgaI	GACGC	2 cut(s)	181, 395
HhaI	GCGC	2 cut(s)	261, 329
Hin1I	GRCGYC	2 cut(s)	192, 259
Hin1II	CATG	2 cut(s)	362, 406
Hin6I	GCGC	2 cut(s)	259, 327
HinP1I	GCGC	2 cut(s)	259, 327
HincII	GTYRAC	1 cut(s)	196
HindII	GTYRAC	1 cut(s)	196
HinfI	GANTC	4 cut(s)	172, 331, 532, 725
HpaII	CCGG	5 cut(s)	85, 256, 262, 268, 413
HphI	GGTGA	2 cut(s)	71, 553
Hpy166II	GTNNAC	1 cut(s)	196
Hpy188I	TCNGA	4 cut(s)	103, 177, 504, 537
Hpy188III	TCNNGA	4 cut(s)	235, 566, 656, 737
Hpy8I	GTNNAC	1 cut(s)	196
Hpy99I	CGWCG	6 cut(s)	107, 157, 160, 197, 200, 236
HpyAV	CCTTC	5 cut(s)	499, 532, 743, 766, 774
HpyCH4III	ACNGT	3 cut(s)	223, 347, 454
HpyCH4IV	ACGT	1 cut(s)	152
HpyCH4V	TGCA	4 cut(s)	340, 386, 635, 695
HpyF10VI	GCNNNNNNNGC	5 cut(s)	30, 60, 250, 613, 692
HpyF3I	CTNAG	3 cut(s)	174, 567, 687
HpySE526I	ACGT	1 cut(s)	152
Hsp92I	GRCGYC	2 cut(s)	192, 259
Hsp92II	CATG	2 cut(s)	362, 406
HspAI	GCGC	2 cut(s)	259, 327
KasI	GGCGCC	1 cut(s)	258
KflI	GGGWCCC	1 cut(s)	144
KroI	GCCGGC	1 cut(s)	261
KroNI	GCCGGC	1 cut(s)	263
Kzo9I	GATC	5 cut(s)	177, 200, 239, 499, 589
LguI	GCTCTTC	1 cut(s)	317
LmnI	GCTCC	5 cut(s)	252, 270, 433, 568, 775
Lsp1109I	GCAGC	6 cut(s)	42, 45, 72, 75, 231, 679
LweI	GCATC	1 cut(s)	622
MaeI	CTAG	1 cut(s)	656
MaeII	ACGT	1 cut(s)	152
MaeIII	GTNAC	1 cut(s)	398
MalI	GATC	5 cut(s)	179, 202, 241, 501, 591
MbiI	CCGCTC	1 cut(s)	189
MboI	GATC	5 cut(s)	177, 200, 239, 499, 589
MboII	GAAGA	5 cut(s)	106, 153, 159, 334, 679
MflI	RGATCY	1 cut(s)	177
MhlI	GDGCHC	1 cut(s)	642
MluCI	AATT	3 cut(s)	444, 525, 609
Mly113I	GGCGCC	1 cut(s)	259
MlyI	GAGTC	2 cut(s)	166, 541
MmeI	TCCRAC	1 cut(s)	126
MnlI	CCTC	7 cut(s)	122, 175, 420, 663, 682, 726, 744
MroNI	GCCGGC	1 cut(s)	261
MseI	TTAA	2 cut(s)	516, 823
MspI	CCGG	5 cut(s)	85, 256, 262, 268, 413
MspR9I	CCNGG	5 cut(s)	256, 309, 414, 432, 794
MvaI	CCWGG	3 cut(s)	309, 432, 794
MvnI	CGCG	2 cut(s)	236, 329
MwoI	GCNNNNNNNGC	5 cut(s)	30, 60, 250, 613, 692
NaeI	GCCGGC	1 cut(s)	263
NarI	GGCGCC	1 cut(s)	259
NciI	CCSGG	2 cut(s)	256, 414
NdeII	GATC	5 cut(s)	177, 200, 239, 499, 589
NgoMIV	GCCGGC	1 cut(s)	261
NlaIII	CATG	2 cut(s)	362, 406
NlaIV	GGNNCC	4 cut(s)	145, 146, 260, 266
NmeAIII	GCCGAG	1 cut(s)	778
NruI	TCGCGA	1 cut(s)	236
NspI	RCATGY	1 cut(s)	406
PceI	AGGCCT	1 cut(s)	753
PciSI	GCTCTTC	1 cut(s)	317
PcsI	WCGNNNNNNNCGW	1 cut(s)	233
PdiI	GCCGGC	1 cut(s)	263
PfeI	GAWTC	2 cut(s)	331, 725
PfoI	TCCNGGA	1 cut(s)	430
PkrI	GCNGC	7 cut(s)	32, 35, 62, 65, 191, 246, 694
PleI	GAGTC	2 cut(s)	166, 540
PluTI	GGCGCC	1 cut(s)	262
PpsI	GAGTC	2 cut(s)	166, 540
PpuMI	RGGWCCY	2 cut(s)	144, 731
Psp5II	RGGWCCY	2 cut(s)	144, 731
Psp6I	CCWGG	3 cut(s)	307, 430, 792
PspGI	CCWGG	3 cut(s)	307, 430, 792
PspN4I	GGNNCC	4 cut(s)	145, 146, 260, 266
PspPI	GGNCC	3 cut(s)	4, 144, 731
PspPPI	RGGWCCY	2 cut(s)	144, 731
PsuI	RGATCY	1 cut(s)	177
RruI	TCGCGA	1 cut(s)	236
SalI	GTCGAC	1 cut(s)	194
SapI	GCTCTTC	1 cut(s)	317
SaqAI	TTAA	2 cut(s)	516, 823
SatI	GCNGC	7 cut(s)	31, 34, 61, 64, 190, 245, 693
Sau3AI	GATC	5 cut(s)	177, 200, 239, 499, 589
Sau96I	GGNCC	3 cut(s)	4, 144, 731
SchI	GAGTC	2 cut(s)	166, 541
ScrFI	CCNGG	5 cut(s)	256, 309, 414, 432, 794
SduI	GDGCHC	1 cut(s)	642
SfaNI	GCATC	1 cut(s)	622
SfcI	CTRYAG	2 cut(s)	19, 182
SfoI	GGCGCC	1 cut(s)	260
SgrDI	CGTCGACG	1 cut(s)	194
SinI	GGWCC	3 cut(s)	4, 144, 731
Sse9I	AATT	3 cut(s)	444, 525, 609
SseBI	AGGCCT	1 cut(s)	753
SsiI	CCGC	4 cut(s)	189, 251, 616, 720
SspDI	GGCGCC	1 cut(s)	258
SspMI	CTAG	1 cut(s)	656
StuI	AGGCCT	1 cut(s)	753
StyD4I	CCNGG	5 cut(s)	254, 307, 412, 430, 792
StyI	CCWWGG	1 cut(s)	510
TaaI	ACNGT	3 cut(s)	223, 347, 454
TaiI	ACGT	1 cut(s)	155
TaqI	TCGA	5 cut(s)	170, 195, 203, 209, 273
TasI	AATT	3 cut(s)	444, 525, 609
TauI	GCSGC	1 cut(s)	192
TfiI	GAWTC	2 cut(s)	331, 725
Tru1I	TTAA	2 cut(s)	516, 823
Tru9I	TTAA	2 cut(s)	516, 823
TseI	GCWGC	6 cut(s)	30, 33, 60, 63, 244, 692
TspDTI	ATGAA	2 cut(s)	318, 780
TspGWI	ACGGA	4 cut(s)	117, 213, 220, 569
VpaK11BI	GGWCC	3 cut(s)	4, 144, 731
XapI	RAATTY	1 cut(s)	609
XbaI	TCTAGA	1 cut(s)	655
XceI	RCATGY	1 cut(s)	406
XmiI	GTMKAC	1 cut(s)	195
XspI	CTAG	1 cut(s)	656

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.