Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000855.1

Orthogroup ID

OG0002921

Physical Location & Seq

Genomic Coordinates Forward (+)

27143 .. 27504

Gene Structure 362 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000855.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 246 bp

atggcttctgagttgaatttggatatgcggagtgatggatttgtgaaggttcatgatcttttagagctaaacttgaaggcatttgctaatattcccttaagctcacatattgttgatgagattaaggaggctgttagaaaggataataagcagcgttttagcctcttggaagaaaatgaggaacttttgatgcgtgcaaaccaaggacgctcaacaacggcaactatcctcgtttatcttgcatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000215 GO:0000394 GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006139 GO:0006388 GO:0006396 GO:0006399 GO:0006725 GO:0006807 GO:0008033 GO:0008150 GO:0008152 GO:0008380 GO:0009987 GO:0010467 GO:0016070 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0034470 GO:0034641 GO:0034660 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0051604 GO:0071704 GO:0090304 GO:0097428 GO:0106035 GO:0140098 GO:0140101 GO:1901360 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

PTS_2-RNA

Protein Analysis

81

Amino Acids

9.22

Weight (kDa)

5.27

Isoelectric Point (pI)

46.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002921)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G45330 AT2G45330 AT5G23600
fragaria_vesca	FvH4_7g11590 FvH4_7g11590 FvH4_7g11590
malus_domestica	MD07G1120400.v1.1
prunus_persica	Prupe.2G143900_v2.0.a1 Prupe.2G143900_v2.0.a1 Prupe.2G143900_v2.0.a1
pyrus_communis	pycom02g16790 pycom02g16820
rosa_chinensis	RchiOBHm_Chr1g0350011 RchiOBHm_Chr7g0199321
rosa_laevigata	RLG00000003800 RLG00000013131 RLG00000028505
rosa_multiflora	Rmu_sc0000855.1_g000007 Rmu_sc0000855.1_g000008 Rmu_sc0003674.1_g000015 Rmu_sc0005220.1_g000003
rosa_roxburghii	Rroxscaffold_3G00256780 Rroxscaffold_3G00256830 Rroxscaffold_4G00305120 Rroxscaffold_4G00305200
rosa_rugosa	Rorug01G0208000
rosa_samantha	Rh1AG224300 Rh1BG191600 Rh1CG209000 Rh1DG220100 Rh6CG241400 Rh7BG181500 Rh7BG181800 Rh7CG187100 Rh7DG181100
rosa_wichuraiana	Rw1G019160 Rw1G019280 Rw7G015660

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	28
AcsI	RAATTY	1 cut(s)	16
AflII	CTTAAG	1 cut(s)	97
AgsI	TTSAA	2 cut(s)	16, 76
AluBI	AGCT	2 cut(s)	67, 102
AluI	AGCT	2 cut(s)	67, 102
ApeKI	GCWGC	1 cut(s)	151
ApoI	RAATTY	1 cut(s)	16
BbvI	GCAGC	1 cut(s)	163
BccI	CCATC	1 cut(s)	29
BceAI	ACGGC	1 cut(s)	234
BfrI	CTTAAG	1 cut(s)	97
BisI	GCNGC	1 cut(s)	152
BlsI	GCNGC	1 cut(s)	153
BmsI	GCATC	1 cut(s)	180
BsaJI	CCNNGG	1 cut(s)	202
BseDI	CCNNGG	1 cut(s)	202
BseXI	GCAGC	1 cut(s)	163
Bsp143I	GATC	1 cut(s)	55
BspACI	CCGC	1 cut(s)	28
BspHI	TCATGA	1 cut(s)	52
BspTI	CTTAAG	1 cut(s)	97
BssECI	CCNNGG	1 cut(s)	202
BssMI	GATC	1 cut(s)	55
BssT1I	CCWWGG	1 cut(s)	202
BstAFI	CTTAAG	1 cut(s)	97
BstC8I	GCNNGC	1 cut(s)	195
BstDEI	CTNAG	1 cut(s)	9
BstKTI	GATC	1 cut(s)	58
BstMBI	GATC	1 cut(s)	55
BstV1I	GCAGC	1 cut(s)	163
Cac8I	GCNNGC	1 cut(s)	195
CciI	TCATGA	1 cut(s)	52
CseI	GACGC	1 cut(s)	216
CviAII	CATG	1 cut(s)	53
CviJI	RGCY	5 cut(s)	5, 67, 102, 131, 162
CviKI_1	RGCY	5 cut(s)	5, 67, 102, 131, 162
DdeI	CTNAG	1 cut(s)	9
DpnI	GATC	1 cut(s)	57
DpnII	GATC	1 cut(s)	55
Eco130I	CCWWGG	1 cut(s)	202
EcoT14I	CCWWGG	1 cut(s)	202
ErhI	CCWWGG	1 cut(s)	202
FaeI	CATG	1 cut(s)	56
FaiI	YATR	4 cut(s)	26, 54, 108, 244
FatI	CATG	1 cut(s)	52
Fnu4HI	GCNGC	1 cut(s)	152
Fsp4HI	GCNGC	1 cut(s)	152
GluI	GCNGC	1 cut(s)	152
HgaI	GACGC	1 cut(s)	216
Hin1II	CATG	1 cut(s)	56
Hpy188I	TCNGA	1 cut(s)	10
Hpy188III	TCNNGA	1 cut(s)	53
HpyAV	CCTTC	2 cut(s)	40, 70
HpyCH4V	TGCA	2 cut(s)	197, 242
HpyF3I	CTNAG	1 cut(s)	9
Hsp92II	CATG	1 cut(s)	56
Kzo9I	GATC	1 cut(s)	55
Lsp1109I	GCAGC	1 cut(s)	163
LweI	GCATC	1 cut(s)	180
MalI	GATC	1 cut(s)	57
MboI	GATC	1 cut(s)	55
MboII	GAAGA	1 cut(s)	182
MluCI	AATT	1 cut(s)	16
MnlI	CCTC	4 cut(s)	121, 172, 173, 239
MseI	TTAA	2 cut(s)	98, 123
MspCI	CTTAAG	1 cut(s)	97
NdeII	GATC	1 cut(s)	55
NlaIII	CATG	1 cut(s)	56
PagI	TCATGA	1 cut(s)	52
PkrI	GCNGC	1 cut(s)	153
SaqAI	TTAA	2 cut(s)	98, 123
SatI	GCNGC	1 cut(s)	152
Sau3AI	GATC	1 cut(s)	55
SetI	ASST	3 cut(s)	51, 69, 104
SfaNI	GCATC	1 cut(s)	180
SgeI	CNNG	6 cut(s)	65, 85, 178, 206, 215, 242
SmlI	CTYRAG	1 cut(s)	97
SmoI	CTYRAG	1 cut(s)	97
Sse9I	AATT	1 cut(s)	16
SsiI	CCGC	1 cut(s)	28
SspI	AATATT	1 cut(s)	91
StyI	CCWWGG	1 cut(s)	202
TasI	AATT	1 cut(s)	16
Tru1I	TTAA	2 cut(s)	98, 123
Tru9I	TTAA	2 cut(s)	98, 123
TseI	GCWGC	1 cut(s)	151
TspDTI	ATGAA	1 cut(s)	41
Vha464I	CTTAAG	1 cut(s)	97
XapI	RAATTY	1 cut(s)	16

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.