Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000988.1

Orthogroup ID

OG0002194

Physical Location & Seq

Genomic Coordinates Reverse (-)

42461 .. 44167

Gene Structure 1707 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000988.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 591 bp

atggggggaagaggattgtttgatcttgaaaaccactttgccttctatggcgcatatcacagcaacccagttaacattttcatccacactctgtttgtgtggccaattctcttcacctctcttgttcttctctacttcacaccttccctgctgaatttcccagctggggtttatcatgggtttttgtttaattttgggtttgttttcactgtgatctatgctttgtattatgttggattggataagaaagctgggtccttggctgctttgctctgtgttctctgctgggttggagccagtgttcttgctagtcgccttgggttttctttggcatggaaggttgtgttggcagctcagttgttctgttggactggacagttcataggccatggggtgtttgagaaacgagcaccagctcttctggacaaccttgtccaagcatttctaatggccccgttctttgtgttacttgaggtccttcaaacggcctttggttatgaatcttatccagggtttcatgcaaatgttaaagaaaagatagaggctaatatcaaagagtggcaagaagagaaacaaaagaaacaatcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF962

Protein Analysis

196

Amino Acids

22.1

Weight (kDa)

7.74

Isoelectric Point (pI)

35.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002194)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G18720 AT1G18720 AT1G74440 AT1G74440
fragaria_vesca	FvH4_4g31090 FvH4_5g14680 FvH4_5g14680 FvH4_5g14680 FvH4_5g14680 FvH4_5g14680 FvH4_5g14680
malus_domestica	MD05G1207900.v1.1 MD06G1195800.v1.1 MD13G1069400.v1.1 MD14G1202900.v1.1 MD16G1069800.v1.1
prunus_persica	Prupe.1G277300_v2.0.a1 Prupe.4G149600_v2.0.a1 Prupe.5G195600_v2.0.a1
pyrus_communis	pycom05g19380 pycom13g06230 pycom14g16770 pycom14g16790 pycom16g06080
rosa_chinensis	RchiOBHm_Chr4g0439471 RchiOBHm_Chr7g0181721
rosa_laevigata	RLG00000005174 RLG00000006268
rosa_multiflora	Rmu_sc0000988.1_g000009 Rmu_sc0007276.1_g000006
rosa_roxburghii	Rroxscaffold_3G00271780 Rroxscaffold_5G00380370
rosa_rugosa	Rorug04G0318500 Rorug06G0442900 Rorug06G0442900
rosa_samantha	Rh4BG381800 Rh4CG396400 Rh4DG376400 Rh7AG045500 Rh7CG046200 Rh7DG045100
rosa_wichuraiana	Rw4G031520 Rw7G003790

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	431
AcoI	YGGCCR	1 cut(s)	101
AcsI	RAATTY	1 cut(s)	154
AfiI	CCNNNNNNNGG	2 cut(s)	166, 484
AgsI	TTSAA	2 cut(s)	29, 482
AjnI	CCWGG	1 cut(s)	508
AjuI	GAANNNNNNNTTGG	2 cut(s)	329, 361
AloI	GAACNNNNNNTCC	2 cut(s)	285, 317
AluBI	AGCT	4 cut(s)	164, 251, 353, 416
AluI	AGCT	4 cut(s)	164, 251, 353, 416
Alw21I	GWGCWC	1 cut(s)	412
AoxI	GGCC	4 cut(s)	101, 385, 450, 486
ApeKI	GCWGC	2 cut(s)	263, 350
ApoI	RAATTY	1 cut(s)	154
AspLEI	GCGC	1 cut(s)	53
AspS9I	GGNCC	3 cut(s)	255, 451, 475
AsuHPI	GGTGA	1 cut(s)	106
AvaII	GGWCC	2 cut(s)	255, 475
BalI	TGGCCA	1 cut(s)	103
Bbv12I	GWGCWC	1 cut(s)	412
BbvI	GCAGC	2 cut(s)	250, 362
BceAI	ACGGC	1 cut(s)	501
BciT130I	CCWGG	1 cut(s)	510
BfaI	CTAG	1 cut(s)	309
BisI	GCNGC	2 cut(s)	264, 351
BlsI	GCNGC	2 cut(s)	265, 352
Bme1390I	CCNGG	1 cut(s)	510
Bme18I	GGWCC	2 cut(s)	255, 475
BmgT120I	GGNCC	3 cut(s)	255, 451, 475
BmiI	GGNNCC	3 cut(s)	256, 295, 453
BmrFI	CCNGG	1 cut(s)	510
BmrI	ACTGGG	1 cut(s)	62
BmuI	ACTGGG	1 cut(s)	62
BpuEI	CTTGAG	1 cut(s)	491
BsaJI	CCNNGG	4 cut(s)	258, 316, 388, 509
BsaXI	ACNNNNNCTCC	2 cut(s)	285, 315
Bsc4I	CCNNNNNNNGG	2 cut(s)	166, 484
Bse1I	ACTGG	3 cut(s)	68, 297, 376
BseBI	CCWGG	1 cut(s)	510
BseDI	CCNNGG	4 cut(s)	258, 316, 388, 509
BseGI	GGATG	1 cut(s)	81
BseLI	CCNNNNNNNGG	2 cut(s)	166, 484
BseMII	CTCAG	1 cut(s)	368
BseNI	ACTGG	3 cut(s)	68, 297, 376
BseXI	GCAGC	2 cut(s)	250, 362
BseYI	CCCAGC	4 cut(s)	160, 164, 251, 285
BshFI	GGCC	4 cut(s)	103, 387, 452, 488
BsiHKAI	GWGCWC	1 cut(s)	412
BslI	CCNNNNNNNGG	2 cut(s)	166, 484
BsnI	GGCC	4 cut(s)	103, 387, 452, 488
Bsp1286I	GDGCHC	1 cut(s)	412
Bsp143I	GATC	2 cut(s)	22, 213
Bsp19I	CCATGG	1 cut(s)	388
BspANI	GGCC	4 cut(s)	103, 387, 452, 488
BspCNI	CTCAG	1 cut(s)	367
BspLI	GGNNCC	3 cut(s)	256, 295, 453
BspQI	GCTCTTC	1 cut(s)	423
BsrI	ACTGG	3 cut(s)	68, 297, 376
BssECI	CCNNGG	4 cut(s)	258, 316, 388, 509
BssMI	GATC	2 cut(s)	22, 213
BssT1I	CCWWGG	3 cut(s)	258, 316, 388
Bst2UI	CCWGG	1 cut(s)	510
Bst4CI	ACNGT	2 cut(s)	211, 378
Bst6I	CTCTTC	4 cut(s)	4, 116, 423, 561
BstDEI	CTNAG	2 cut(s)	354, 588
BstDSI	CCRYGG	1 cut(s)	388
BstF5I	GGATG	1 cut(s)	81
BstHHI	GCGC	1 cut(s)	53
BstKTI	GATC	2 cut(s)	25, 216
BstMBI	GATC	2 cut(s)	22, 213
BstNI	CCWGG	1 cut(s)	510
BstSCI	CCNGG	1 cut(s)	508
BstV1I	GCAGC	2 cut(s)	250, 362
BsuRI	GGCC	4 cut(s)	103, 387, 452, 488
BtgI	CCRYGG	1 cut(s)	388
BtsCI	GGATG	1 cut(s)	81
BtsIMutI	CAGTG	2 cut(s)	207, 304
CfoI	GCGC	1 cut(s)	53
Cfr13I	GGNCC	3 cut(s)	255, 451, 475
CviAII	CATG	4 cut(s)	176, 333, 389, 518
DdeI	CTNAG	2 cut(s)	354, 588
DpnI	GATC	2 cut(s)	24, 215
DpnII	GATC	2 cut(s)	22, 213
DrdI	GACNNNNNNGTC	1 cut(s)	431
DseDI	GACNNNNNNGTC	1 cut(s)	431
EaeI	YGGCCR	1 cut(s)	101
Eam1104I	CTCTTC	4 cut(s)	4, 116, 423, 561
EarI	CTCTTC	4 cut(s)	4, 116, 423, 561
Eco130I	CCWWGG	3 cut(s)	258, 316, 388
Eco47I	GGWCC	2 cut(s)	255, 475
EcoO109I	RGGNCCY	2 cut(s)	255, 475
EcoRII	CCWGG	1 cut(s)	508
EcoT14I	CCWWGG	3 cut(s)	258, 316, 388
ErhI	CCWWGG	3 cut(s)	258, 316, 388
FaeI	CATG	4 cut(s)	179, 336, 392, 521
FatI	CATG	4 cut(s)	175, 332, 388, 517
Fnu4HI	GCNGC	2 cut(s)	264, 351
FokI	GGATG	1 cut(s)	68
Fsp4HI	GCNGC	2 cut(s)	264, 351
FspBI	CTAG	1 cut(s)	309
GlaI	GCGC	1 cut(s)	52
GluI	GCNGC	2 cut(s)	264, 351
GsaI	CCCAGC	4 cut(s)	164, 168, 255, 289
HaeIII	GGCC	4 cut(s)	103, 387, 452, 488
HhaI	GCGC	1 cut(s)	53
Hin1II	CATG	4 cut(s)	179, 336, 392, 521
Hin6I	GCGC	1 cut(s)	51
HinP1I	GCGC	1 cut(s)	51
HincII	GTYRAC	1 cut(s)	73
HindII	GTYRAC	1 cut(s)	73
HinfI	GANTC	1 cut(s)	500
HpaI	GTTAAC	1 cut(s)	73
HphI	GGTGA	1 cut(s)	106
Hpy166II	GTNNAC	1 cut(s)	73
Hpy188III	TCNNGA	2 cut(s)	26, 422
Hpy8I	GTNNAC	1 cut(s)	73
HpyAV	CCTTC	4 cut(s)	52, 153, 331, 488
HpyCH4III	ACNGT	2 cut(s)	211, 378
HpyCH4V	TGCA	1 cut(s)	521
HpyF3I	CTNAG	2 cut(s)	354, 588
Hsp92II	CATG	4 cut(s)	179, 336, 392, 521
HspAI	GCGC	1 cut(s)	51
KspAI	GTTAAC	1 cut(s)	73
Kzo9I	GATC	2 cut(s)	22, 213
LguI	GCTCTTC	1 cut(s)	423
LmnI	GCTCC	1 cut(s)	293
Lsp1109I	GCAGC	2 cut(s)	250, 362
MaeI	CTAG	1 cut(s)	309
MaeIII	GTNAC	1 cut(s)	465
MalI	GATC	2 cut(s)	24, 215
MboI	GATC	2 cut(s)	22, 213
MboII	GAAGA	5 cut(s)	21, 103, 119, 410, 578
MhlI	GDGCHC	1 cut(s)	412
MlsI	TGGCCA	1 cut(s)	103
MluCI	AATT	3 cut(s)	105, 154, 190
MluNI	TGGCCA	1 cut(s)	103
MmeI	TCCRAC	3 cut(s)	214, 271, 347
MnlI	CCTC	4 cut(s)	5, 127, 466, 535
Mox20I	TGGCCA	1 cut(s)	103
MscI	TGGCCA	1 cut(s)	103
MseI	TTAA	3 cut(s)	72, 189, 528
MslI	CAYNNNNRTG	1 cut(s)	522
Msp20I	TGGCCA	1 cut(s)	103
MspA1I	CMGCKG	1 cut(s)	164
MspR9I	CCNGG	1 cut(s)	510
MvaI	CCWGG	1 cut(s)	510
NcoI	CCATGG	1 cut(s)	388
NdeII	GATC	2 cut(s)	22, 213
NlaIII	CATG	4 cut(s)	179, 336, 392, 521
NlaIV	GGNNCC	3 cut(s)	256, 295, 453
PciSI	GCTCTTC	1 cut(s)	423
PfeI	GAWTC	1 cut(s)	500
PkrI	GCNGC	2 cut(s)	265, 352
PpuMI	RGGWCCY	2 cut(s)	255, 475
Psp5II	RGGWCCY	2 cut(s)	255, 475
Psp6I	CCWGG	1 cut(s)	508
PspFI	CCCAGC	4 cut(s)	160, 164, 251, 285
PspGI	CCWGG	1 cut(s)	508
PspN4I	GGNNCC	3 cut(s)	256, 295, 453
PspPI	GGNCC	3 cut(s)	255, 451, 475
PspPPI	RGGWCCY	2 cut(s)	255, 475
PvuII	CAGCTG	1 cut(s)	164
RseI	CAYNNNNRTG	1 cut(s)	522
SapI	GCTCTTC	1 cut(s)	423
SaqAI	TTAA	3 cut(s)	72, 189, 528
SatI	GCNGC	2 cut(s)	264, 351
Sau3AI	GATC	2 cut(s)	22, 213
Sau96I	GGNCC	3 cut(s)	255, 451, 475
ScrFI	CCNGG	1 cut(s)	510
SduI	GDGCHC	1 cut(s)	412
SetI	ASST	9 cut(s)	119, 145, 166, 253, 342, 355, 418, 432, 477
SinI	GGWCC	2 cut(s)	255, 475
SmiMI	CAYNNNNRTG	1 cut(s)	522
SmlI	CTYRAG	1 cut(s)	470
SmoI	CTYRAG	1 cut(s)	470
Sse9I	AATT	3 cut(s)	105, 154, 190
SspMI	CTAG	1 cut(s)	309
StyD4I	CCNGG	1 cut(s)	508
StyI	CCWWGG	3 cut(s)	258, 316, 388
TaaI	ACNGT	2 cut(s)	211, 378
TasI	AATT	3 cut(s)	105, 154, 190
TfiI	GAWTC	1 cut(s)	500
Tru1I	TTAA	3 cut(s)	72, 189, 528
Tru9I	TTAA	3 cut(s)	72, 189, 528
TscAI	CASTG	2 cut(s)	214, 304
TseI	GCWGC	2 cut(s)	263, 350
TspDTI	ATGAA	4 cut(s)	70, 370, 506, 513
TspRI	CASTG	2 cut(s)	214, 304
VpaK11BI	GGWCC	2 cut(s)	255, 475
XapI	RAATTY	1 cut(s)	154
XspI	CTAG	1 cut(s)	309

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.