Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001974.1

Orthogroup ID

OG0007494

Physical Location & Seq

Genomic Coordinates Reverse (-)

79589 .. 80134

Gene Structure 546 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001974.1_g000021.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 546 bp

atggattccaagaacattcaagtcatctcgaagaacaagtccaagacaacgaccaccaaatcgagcagcagctcatctggtcatgtcactcgaagcatggcaaaggttcagccaataacatttgtggctttgccttctaagcttcgccaaccaatcatcaccctggaaagtttaggggtagggaagcatgtctctcgaagtgaagagagacaagctccaactacaaaatcaagggagcggtcgttctcacctgcctctgatgacaattcaagcactggatcataccatggaagtcctgatcctgaagaaaataacacttctgggatgcagtcagacagtgtgtctcacctttcagcaatgcaagtcatgatgactggggcaaccacgctcgaagagcaggtagctaatctgatggaggcggttcaaaagctcactaatactgtcaaagaaaaagatatgcagattgctcaactttggagcaggttcgagaaacaaaatgatgaggattctgctaggattccatacaagaatgacaaagagaaataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Retrotrans_gag

Protein Analysis

181

Amino Acids

19.95

Weight (kDa)

8.78

Isoelectric Point (pI)

55.29

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007494)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g22807 FvH4_4g22272
rosa_multiflora	Rmu_co8079694.1_g000001 Rmu_co8228495.1_g000001 Rmu_co8247513.1_g000001 Rmu_co8363681.1_g000001 Rmu_sc0000670.1_g000024 Rmu_sc0001107.1_g000006 Rmu_sc0001307.1_g000020 Rmu_sc0001438.1_g000045 Rmu_sc0001974.1_g000021 Rmu_sc0001981.1_g000010 Rmu_sc0002958.1_g000004 Rmu_sc0003069.1_g000031 Rmu_sc0003553.1_g000003 Rmu_sc0004234.1_g000005 Rmu_sc0004805.1_g000048 Rmu_sc0009186.1_g000007 Rmu_sc0009528.1_g000010 Rmu_sc0011242.1_g000005 Rmu_sc0013028.1_g000012 Rmu_sc0029038.1_g000001 Rmu_sc0041876.1_g000001 Rmu_ssc0000395.1_g000052
rosa_roxburghii	Rroxscaffold_3G00228150

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	259
Acc36I	ACCTGC	3 cut(s)	259, 388, 471
AccBSI	CCGCTC	1 cut(s)	238
AciI	CCGC	2 cut(s)	238, 419
AclWI	GGATC	2 cut(s)	286, 293
AcuI	CTGAAG	1 cut(s)	324
AgsI	TTSAA	3 cut(s)	20, 270, 425
AhdI	GACNNNNNGTC	1 cut(s)	340
AjnI	CCWGG	1 cut(s)	162
AloI	GAACNNNNNNTCC	2 cut(s)	227, 259
AluBI	AGCT	5 cut(s)	72, 142, 215, 404, 430
AluI	AGCT	5 cut(s)	72, 142, 215, 404, 430
Alw26I	GTCTC	3 cut(s)	196, 202, 348
AlwI	GGATC	2 cut(s)	286, 293
ApeKI	GCWGC	2 cut(s)	66, 69
ArsI	GACNNNNNNTTYG	2 cut(s)	23, 55
AsuHPI	GGTGA	3 cut(s)	151, 240, 338
BbvI	GCAGC	2 cut(s)	78, 81
BccI	CCATC	1 cut(s)	406
BcgI	CGANNNNNNTGC	2 cut(s)	176, 210
BciT130I	CCWGG	1 cut(s)	164
BcoDI	GTCTC	3 cut(s)	196, 202, 348
BfaI	CTAG	1 cut(s)	513
BfuAI	ACCTGC	3 cut(s)	259, 388, 471
BisI	GCNGC	2 cut(s)	67, 70
BlsI	GCNGC	2 cut(s)	68, 71
Bme1390I	CCNGG	1 cut(s)	164
BmeRI	GACNNNNNGTC	1 cut(s)	340
BmrFI	CCNGG	1 cut(s)	164
BmrI	ACTGGG	1 cut(s)	384
BmsI	GCATC	1 cut(s)	315
BmuI	ACTGGG	1 cut(s)	384
BplI	GAGNNNNNCTC	2 cut(s)	199, 231
BsaJI	CCNNGG	2 cut(s)	162, 286
BsaXI	ACNNNNNCTCC	2 cut(s)	227, 257
Bse1I	ACTGG	2 cut(s)	280, 379
Bse3DI	GCAATG	1 cut(s)	363
BseBI	CCWGG	1 cut(s)	164
BseDI	CCNNGG	2 cut(s)	162, 286
BseGI	GGATG	1 cut(s)	330
BseMI	GCAATG	1 cut(s)	363
BseNI	ACTGG	2 cut(s)	280, 379
BseXI	GCAGC	2 cut(s)	78, 81
Bsh1285I	CGRYCG	1 cut(s)	242
BsiEI	CGRYCG	1 cut(s)	242
BsmAI	GTCTC	3 cut(s)	196, 202, 348
Bsp143I	GATC	2 cut(s)	278, 298
Bsp19I	CCATGG	1 cut(s)	286
BspACI	CCGC	2 cut(s)	238, 419
BspHI	TCATGA	1 cut(s)	366
BspMI	ACCTGC	3 cut(s)	259, 388, 471
BspPI	GGATC	2 cut(s)	286, 293
BspQI	GCTCTTC	1 cut(s)	387
BsrBI	CCGCTC	1 cut(s)	238
BsrDI	GCAATG	1 cut(s)	363
BsrI	ACTGG	2 cut(s)	280, 379
BssECI	CCNNGG	2 cut(s)	162, 286
BssMI	GATC	2 cut(s)	278, 298
BssT1I	CCWWGG	1 cut(s)	286
Bst2UI	CCWGG	1 cut(s)	164
Bst4CI	ACNGT	2 cut(s)	338, 442
Bst6I	CTCTTC	2 cut(s)	198, 387
BstDEI	CTNAG	1 cut(s)	138
BstDSI	CCRYGG	1 cut(s)	286
BstF5I	GGATG	1 cut(s)	330
BstKTI	GATC	2 cut(s)	281, 301
BstMAI	GTCTC	3 cut(s)	196, 202, 348
BstMBI	GATC	2 cut(s)	278, 298
BstMCI	CGRYCG	1 cut(s)	242
BstMWI	GCNNNNNNNGC	2 cut(s)	139, 394
BstNI	CCWGG	1 cut(s)	164
BstNSI	RCATGY	1 cut(s)	191
BstSCI	CCNGG	1 cut(s)	162
BstV1I	GCAGC	2 cut(s)	78, 81
BtgI	CCRYGG	1 cut(s)	286
BtsCI	GGATG	1 cut(s)	330
BtsIMutI	CAGTG	2 cut(s)	273, 343
BveI	ACCTGC	3 cut(s)	259, 388, 471
CciI	TCATGA	1 cut(s)	366
CviAII	CATG	5 cut(s)	83, 97, 188, 287, 367
CviJI	RGCY	7 cut(s)	72, 112, 128, 142, 215, 404, 430
CviKI_1	RGCY	7 cut(s)	72, 112, 128, 142, 215, 404, 430
DdeI	CTNAG	1 cut(s)	138
DpnI	GATC	2 cut(s)	280, 300
DpnII	GATC	2 cut(s)	278, 298
DriI	GACNNNNNGTC	1 cut(s)	340
Eam1104I	CTCTTC	2 cut(s)	198, 387
Eam1105I	GACNNNNNGTC	1 cut(s)	340
EarI	CTCTTC	2 cut(s)	198, 387
Eco130I	CCWWGG	1 cut(s)	286
Eco57I	CTGAAG	1 cut(s)	324
EcoRII	CCWGG	1 cut(s)	162
EcoT14I	CCWWGG	1 cut(s)	286
ErhI	CCWWGG	1 cut(s)	286
FaeI	CATG	5 cut(s)	86, 100, 191, 290, 370
FaiI	YATR	8 cut(s)	84, 98, 189, 283, 288, 368, 458, 523
FatI	CATG	5 cut(s)	82, 96, 187, 286, 366
Fnu4HI	GCNGC	2 cut(s)	67, 70
FokI	GGATG	1 cut(s)	337
Fsp4HI	GCNGC	2 cut(s)	67, 70
FspBI	CTAG	1 cut(s)	513
GluI	GCNGC	2 cut(s)	67, 70
Hin1II	CATG	5 cut(s)	86, 100, 191, 290, 370
HindIII	AAGCTT	1 cut(s)	140
HinfI	GANTC	3 cut(s)	5, 506, 517
HphI	GGTGA	3 cut(s)	151, 240, 338
Hpy188I	TCNGA	3 cut(s)	259, 334, 411
Hpy188III	TCNNGA	6 cut(s)	28, 195, 296, 302, 367, 487
HpyAV	CCTTC	1 cut(s)	144
HpyCH4III	ACNGT	2 cut(s)	338, 442
HpyCH4V	TGCA	3 cut(s)	328, 361, 460
HpyF10VI	GCNNNNNNNGC	2 cut(s)	139, 394
HpyF3I	CTNAG	1 cut(s)	138
Hsp92II	CATG	5 cut(s)	86, 100, 191, 290, 370
Kzo9I	GATC	2 cut(s)	278, 298
LguI	GCTCTTC	1 cut(s)	387
LmnI	GCTCC	3 cut(s)	220, 235, 477
Lsp1109I	GCAGC	2 cut(s)	78, 81
LweI	GCATC	1 cut(s)	315
MaeI	CTAG	1 cut(s)	513
MaeIII	GTNAC	1 cut(s)	85
MalI	GATC	2 cut(s)	280, 300
MbiI	CCGCTC	1 cut(s)	238
MboI	GATC	2 cut(s)	278, 298
MboII	GAAGA	4 cut(s)	43, 215, 317, 404
MluCI	AATT	1 cut(s)	265
MmeI	TCCRAC	1 cut(s)	242
MnlI	CCTC	3 cut(s)	265, 409, 496
MspR9I	CCNGG	1 cut(s)	164
MvaI	CCWGG	1 cut(s)	164
MwoI	GCNNNNNNNGC	2 cut(s)	139, 394
NcoI	CCATGG	1 cut(s)	286
NdeII	GATC	2 cut(s)	278, 298
NlaIII	CATG	5 cut(s)	86, 100, 191, 290, 370
NmuCI	GTSAC	1 cut(s)	85
NspI	RCATGY	1 cut(s)	191
PagI	TCATGA	1 cut(s)	366
PaqCI	CACCTGC	1 cut(s)	259
PciSI	GCTCTTC	1 cut(s)	387
PfeI	GAWTC	3 cut(s)	5, 506, 517
PkrI	GCNGC	2 cut(s)	68, 71
Psp6I	CCWGG	1 cut(s)	162
PspGI	CCWGG	1 cut(s)	162
SapI	GCTCTTC	1 cut(s)	387
SatI	GCNGC	2 cut(s)	67, 70
Sau3AI	GATC	2 cut(s)	278, 298
ScrFI	CCNGG	1 cut(s)	164
SfaNI	GCATC	1 cut(s)	315
Sse9I	AATT	1 cut(s)	265
SsiI	CCGC	2 cut(s)	238, 419
SspMI	CTAG	1 cut(s)	513
StyD4I	CCNGG	1 cut(s)	162
StyI	CCWWGG	1 cut(s)	286
TaaI	ACNGT	2 cut(s)	338, 442
TaqI	TCGA	6 cut(s)	29, 62, 91, 196, 390, 486
TasI	AATT	1 cut(s)	265
TfiI	GAWTC	3 cut(s)	5, 506, 517
TscAI	CASTG	2 cut(s)	280, 343
TseFI	GTSAC	1 cut(s)	85
TseI	GCWGC	2 cut(s)	66, 69
Tsp45I	GTSAC	1 cut(s)	85
TspRI	CASTG	2 cut(s)	280, 343
XceI	RCATGY	1 cut(s)	191
XspI	CTAG	1 cut(s)	513

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.