Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002501.1

Orthogroup ID

OG0002061

Physical Location & Seq

Genomic Coordinates Reverse (-)

169356 .. 172628

Gene Structure 3273 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002501.1_g000043.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 867 bp

atgtctctgtttgatttggtacagcggtatggggtttcagtgttctgtgttctgagttgcagttcagtgaggagtaagagcattttcttgttcatccatgggatcttccggacttgctcttttggttctttcatagttggaaaaggacacagaacactgaaacccaatgtgtttgaggaaaagaacacagaacatcttgatcaatttgaggaaaagaagagttctcaaaagggatcatcgagccattcgtggcatccaatcatgactacggatactacggttctaaggtattggtggaactggaggttcttgatcagtgcaatatttatattgtctagtatgcttggatcttcactctccatttatggatgctacaaataccgcaatagagttggtgaggatgcagctgattttgtgagacatgaagaacgaggtagtacttatgttgctccaacacttggcaaaaatgcagatacatccaactcatctaaaagtttcactgacgaagaatgtccctcccacaaaggcgctggtctgattgtttatatctttcaagtcatttatcagatgtgtgggggtgctgtggtgctcactgatgtggtattttggctcattctgtatccatttttaacaagcaaagattacaaactggactttatgatggccagtatgcactcattcaatcttgttttcctccttggtgagacaactttgaatagcttgttcaacgaccaaggtcgttccagaagcatggagaagtccagaaccaaggtcgttccagaaccaaggtcgtatggaagacccaaccggaactttcgattccggccatatcacggcggcggaccactggcattcgcttcttcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

288

Amino Acids

32.79

Weight (kDa)

9.26

Isoelectric Point (pI)

37.09

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002061)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G10660 AT1G10660 AT1G10660 AT1G10660 AT1G70505 AT1G70505 AT1G70505 AT1G70505
fragaria_vesca	FvH4_4g32871 FvH4_4g32900 FvH4_4g32900
malus_domestica	MD13G1094600.v1.1 MD16G1095700.v1.1
prunus_persica	Prupe.1G250800_v2.0.a1 Prupe.1G250800_v2.0.a1
pyrus_communis	pycom13g08240 pycom16g08170
rosa_chinensis	RchiOBHm_Chr4g0441901 RchiOBHm_Chr4g0441931 RchiOBHm_Chr5g0073411
rosa_laevigata	RLG00000006056 RLG00000006058 RLG00000036385
rosa_multiflora	Rmu_sc0001997.1_g000013 Rmu_sc0002501.1_g000043 Rmu_sc0008316.1_g000012 Rmu_sc0011990.1_g000015
rosa_roxburghii	Rroxscaffold_1G00007810 Rroxscaffold_5G00382710 Rroxscaffold_5G00382760
rosa_rugosa	Rorug04G0336900 Rorug04G0337000 Rorug04G0337000 Rorug05G0423500
rosa_samantha	Rh4AG388500 Rh4AG388900 Rh4BG402200 Rh4CG417300 Rh5AG480200 Rh5BG501200 Rh5CG524200
rosa_wichuraiana	Rw4G033550 Rw4G033580 Rw5G044630

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	458
AccIII	TCCGGA	1 cut(s)	108
AciI	CCGC	4 cut(s)	25, 382, 837, 840
AclWI	GGATC	3 cut(s)	110, 241, 355
AcoI	YGGCCR	2 cut(s)	663, 824
AfaI	GTAC	2 cut(s)	21, 439
AfiI	CCNNNNNNNGG	2 cut(s)	458, 833
AgsI	TTSAA	4 cut(s)	554, 682, 715, 727
AleI	CACNNNNGTG	1 cut(s)	596
AluBI	AGCT	2 cut(s)	407, 720
AluI	AGCT	2 cut(s)	407, 720
Alw21I	GWGCWC	1 cut(s)	591
Alw26I	GTCTC	3 cut(s)	9, 412, 698
AlwI	GGATC	3 cut(s)	110, 241, 355
Aor13HI	TCCGGA	1 cut(s)	108
AoxI	GGCC	2 cut(s)	663, 824
ApeKI	GCWGC	1 cut(s)	404
AspLEI	GCGC	1 cut(s)	530
AspS9I	GGNCC	1 cut(s)	842
AsuHPI	GGTGA	2 cut(s)	407, 713
AvaII	GGWCC	1 cut(s)	842
BaeI	ACNNNNGTAYC	4 cut(s)	11, 44, 264, 297
BalI	TGGCCA	1 cut(s)	665
BbsI	GAAGAC	1 cut(s)	805
Bbv12I	GWGCWC	1 cut(s)	591
BbvI	GCAGC	1 cut(s)	416
BccI	CCATC	1 cut(s)	655
BceAI	ACGGC	1 cut(s)	850
BciVI	GTATCC	2 cut(s)	265, 630
BclI	TGATCA	2 cut(s)	199, 312
BcoDI	GTCTC	3 cut(s)	9, 412, 698
BfaI	CTAG	1 cut(s)	336
BfoI	RGCGCY	1 cut(s)	531
BfuI	GTATCC	2 cut(s)	265, 630
BisI	GCNGC	2 cut(s)	405, 838
BlsI	GCNGC	2 cut(s)	406, 839
BmcAI	AGTACT	1 cut(s)	439
Bme18I	GGWCC	1 cut(s)	842
BmgT120I	GGNCC	1 cut(s)	842
BmsI	GCATC	3 cut(s)	262, 359, 391
BoxI	GACNNNNGTC	1 cut(s)	735
BpiI	GAAGAC	1 cut(s)	805
BpmI	CTGGAG	1 cut(s)	322
BsaJI	CCNNGG	5 cut(s)	97, 697, 733, 768, 785
BsaWI	WCCGGW	2 cut(s)	108, 807
Bsc4I	CCNNNNNNNGG	2 cut(s)	458, 833
Bse1I	ACTGG	4 cut(s)	305, 654, 666, 852
BseAI	TCCGGA	1 cut(s)	108
BseDI	CCNNGG	5 cut(s)	97, 697, 733, 768, 785
BseGI	GGATG	5 cut(s)	93, 253, 374, 406, 476
BseLI	CCNNNNNNNGG	2 cut(s)	458, 833
BseMII	CTCAG	1 cut(s)	44
BseNI	ACTGG	4 cut(s)	305, 654, 666, 852
BseRI	GAGGAG	1 cut(s)	85
BseXI	GCAGC	1 cut(s)	416
BshFI	GGCC	2 cut(s)	665, 826
BsiHKAI	GWGCWC	1 cut(s)	591
BsiSI	CCGG	3 cut(s)	109, 808, 823
BslFI	GGGAC	1 cut(s)	498
BslI	CCNNNNNNNGG	2 cut(s)	458, 833
BsmAI	GTCTC	3 cut(s)	9, 412, 698
BsmFI	GGGAC	1 cut(s)	498
BsmI	GAATGC	1 cut(s)	851
BsnI	GGCC	2 cut(s)	665, 826
Bsp1286I	GDGCHC	1 cut(s)	591
Bsp13I	TCCGGA	1 cut(s)	108
Bsp143I	GATC	5 cut(s)	102, 199, 233, 312, 347
Bsp19I	CCATGG	1 cut(s)	97
BspACI	CCGC	4 cut(s)	25, 382, 837, 840
BspANI	GGCC	2 cut(s)	665, 826
BspCNI	CTCAG	1 cut(s)	45
BspEI	TCCGGA	1 cut(s)	108
BspHI	TCATGA	1 cut(s)	261
BspPI	GGATC	3 cut(s)	110, 241, 355
BsrI	ACTGG	4 cut(s)	305, 654, 666, 852
BssECI	CCNNGG	5 cut(s)	97, 697, 733, 768, 785
BssMI	GATC	5 cut(s)	102, 199, 233, 312, 347
BssT1I	CCWWGG	5 cut(s)	97, 697, 733, 768, 785
Bst4CI	ACNGT	1 cut(s)	280
Bst6I	CTCTTC	1 cut(s)	212
BstDEI	CTNAG	2 cut(s)	53, 284
BstDSI	CCRYGG	1 cut(s)	97
BstF5I	GGATG	5 cut(s)	93, 253, 374, 406, 476
BstH2I	RGCGCY	1 cut(s)	531
BstHHI	GCGC	1 cut(s)	530
BstKTI	GATC	5 cut(s)	105, 202, 236, 315, 350
BstMAI	GTCTC	3 cut(s)	9, 412, 698
BstMBI	GATC	5 cut(s)	102, 199, 233, 312, 347
BstPAI	GACNNNNGTC	1 cut(s)	735
BstV1I	GCAGC	1 cut(s)	416
BstV2I	GAAGAC	1 cut(s)	805
BstX2I	RGATCY	2 cut(s)	102, 347
BstXI	CCANNNNNNTGG	1 cut(s)	751
BstYI	RGATCY	2 cut(s)	102, 347
BsuI	GTATCC	2 cut(s)	265, 630
BsuRI	GGCC	2 cut(s)	665, 826
BtgI	CCRYGG	1 cut(s)	97
BtsCI	GGATG	5 cut(s)	93, 253, 374, 406, 476
BtsIMutI	CAGTG	7 cut(s)	45, 72, 155, 322, 498, 591, 845
CciI	TCATGA	1 cut(s)	261
CfoI	GCGC	1 cut(s)	530
Cfr13I	GGNCC	1 cut(s)	842
Csp6I	GTAC	2 cut(s)	20, 438
CviAII	CATG	4 cut(s)	98, 262, 422, 751
CviJI	RGCY	6 cut(s)	243, 407, 610, 665, 720, 826
CviKI_1	RGCY	6 cut(s)	243, 407, 610, 665, 720, 826
CviQI	GTAC	2 cut(s)	20, 438
DdeI	CTNAG	2 cut(s)	53, 284
DpnI	GATC	5 cut(s)	104, 201, 235, 314, 349
DpnII	GATC	5 cut(s)	102, 199, 233, 312, 347
EaeI	YGGCCR	2 cut(s)	663, 824
Eam1104I	CTCTTC	1 cut(s)	212
EarI	CTCTTC	1 cut(s)	212
EciI	GGCGGA	1 cut(s)	855
Eco130I	CCWWGG	5 cut(s)	97, 697, 733, 768, 785
Eco47I	GGWCC	1 cut(s)	842
EcoT14I	CCWWGG	5 cut(s)	97, 697, 733, 768, 785
ErhI	CCWWGG	5 cut(s)	97, 697, 733, 768, 785
FaeI	CATG	4 cut(s)	101, 265, 425, 754
FaqI	GGGAC	1 cut(s)	498
FatI	CATG	4 cut(s)	97, 261, 421, 750
FbaI	TGATCA	2 cut(s)	199, 312
Fnu4HI	GCNGC	2 cut(s)	405, 838
FokI	GGATG	5 cut(s)	80, 240, 381, 413, 463
Fsp4HI	GCNGC	2 cut(s)	405, 838
FspBI	CTAG	1 cut(s)	336
GlaI	GCGC	1 cut(s)	529
GluI	GCNGC	2 cut(s)	405, 838
GsuI	CTGGAG	1 cut(s)	322
HaeII	RGCGCY	1 cut(s)	531
HaeIII	GGCC	2 cut(s)	665, 826
HapII	CCGG	3 cut(s)	109, 808, 823
HhaI	GCGC	1 cut(s)	530
Hin1II	CATG	4 cut(s)	101, 265, 425, 754
Hin6I	GCGC	1 cut(s)	528
HinP1I	GCGC	1 cut(s)	528
HinfI	GANTC	1 cut(s)	819
HpaII	CCGG	3 cut(s)	109, 808, 823
HphI	GGTGA	2 cut(s)	407, 713
Hpy188I	TCNGA	3 cut(s)	54, 537, 567
Hpy188III	TCNNGA	8 cut(s)	109, 197, 262, 310, 744, 762, 779, 864
HpyCH4III	ACNGT	1 cut(s)	280
HpyCH4V	TGCA	5 cut(s)	60, 320, 404, 470, 673
HpyF3I	CTNAG	2 cut(s)	53, 284
Hsp92II	CATG	4 cut(s)	101, 265, 425, 754
HspAI	GCGC	1 cut(s)	528
Kpn2I	TCCGGA	1 cut(s)	108
Ksp22I	TGATCA	2 cut(s)	199, 312
Kzo9I	GATC	5 cut(s)	102, 199, 233, 312, 347
LmnI	GCTCC	1 cut(s)	454
Lsp1109I	GCAGC	1 cut(s)	416
LweI	GCATC	3 cut(s)	262, 359, 391
MaeI	CTAG	1 cut(s)	336
MalI	GATC	5 cut(s)	104, 201, 235, 314, 349
MboI	GATC	5 cut(s)	102, 199, 233, 312, 347
MboII	GAAGA	7 cut(s)	97, 229, 342, 437, 518, 810, 852
MflI	RGATCY	2 cut(s)	102, 347
MhlI	GDGCHC	1 cut(s)	591
MlsI	TGGCCA	1 cut(s)	665
MluCI	AATT	1 cut(s)	203
MluNI	TGGCCA	1 cut(s)	665
MmeI	TCCRAC	3 cut(s)	118, 476, 504
MnlI	CCTC	8 cut(s)	63, 169, 202, 297, 391, 425, 526, 704
Mox20I	TGGCCA	1 cut(s)	665
MroI	TCCGGA	1 cut(s)	108
MscI	TGGCCA	1 cut(s)	665
MseI	TTAA	1 cut(s)	629
MslI	CAYNNNNRTG	1 cut(s)	596
Msp20I	TGGCCA	1 cut(s)	665
MspA1I	CMGCKG	2 cut(s)	25, 407
MspI	CCGG	3 cut(s)	109, 808, 823
Mva1269I	GAATGC	1 cut(s)	851
NcoI	CCATGG	1 cut(s)	97
NdeII	GATC	5 cut(s)	102, 199, 233, 312, 347
NlaIII	CATG	4 cut(s)	101, 265, 425, 754
OliI	CACNNNNGTG	1 cut(s)	596
PagI	TCATGA	1 cut(s)	261
PcsI	WCGNNNNNNNCGW	1 cut(s)	245
PctI	GAATGC	1 cut(s)	851
PfeI	GAWTC	1 cut(s)	819
PflMI	CCANNNNNTGG	1 cut(s)	458
PkrI	GCNGC	2 cut(s)	406, 839
PshAI	GACNNNNGTC	1 cut(s)	735
PspPI	GGNCC	1 cut(s)	842
PsuI	RGATCY	2 cut(s)	102, 347
PvuII	CAGCTG	1 cut(s)	407
RsaI	GTAC	2 cut(s)	21, 439
RsaNI	GTAC	2 cut(s)	20, 438
RseI	CAYNNNNRTG	1 cut(s)	596
SaqAI	TTAA	1 cut(s)	629
SatI	GCNGC	2 cut(s)	405, 838
Sau3AI	GATC	5 cut(s)	102, 199, 233, 312, 347
Sau96I	GGNCC	1 cut(s)	842
ScaI	AGTACT	1 cut(s)	439
SduI	GDGCHC	1 cut(s)	591
SetI	ASST	8 cut(s)	290, 308, 409, 436, 722, 739, 774, 791
SfaNI	GCATC	3 cut(s)	262, 359, 391
SinI	GGWCC	1 cut(s)	842
SmiMI	CAYNNNNRTG	1 cut(s)	596
Sse9I	AATT	1 cut(s)	203
SsiI	CCGC	4 cut(s)	25, 382, 837, 840
SspI	AATATT	1 cut(s)	324
SspMI	CTAG	1 cut(s)	336
StyI	CCWWGG	5 cut(s)	97, 697, 733, 768, 785
TaaI	ACNGT	1 cut(s)	280
TaqI	TCGA	2 cut(s)	239, 817
TasI	AATT	1 cut(s)	203
TatI	WGTACW	1 cut(s)	437
TauI	GCSGC	1 cut(s)	840
TfiI	GAWTC	1 cut(s)	819
Tru1I	TTAA	1 cut(s)	629
Tru9I	TTAA	1 cut(s)	629
TscAI	CASTG	7 cut(s)	45, 72, 162, 322, 505, 598, 852
TseI	GCWGC	1 cut(s)	404
TspDTI	ATGAA	3 cut(s)	82, 121, 438
TspGWI	ACGGA	1 cut(s)	284
TspRI	CASTG	7 cut(s)	45, 72, 162, 322, 505, 598, 852
Van91I	CCANNNNNTGG	1 cut(s)	458
VpaK11BI	GGWCC	1 cut(s)	842
XcmI	CCANNNNNNNNNTGG	1 cut(s)	527
XspI	CTAG	1 cut(s)	336
ZrmI	AGTACT	1 cut(s)	439

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.