Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002609.1

Orthogroup ID

OG0004835

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1100

Gene Structure 1100 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002609.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 672 bp

ataccactaagtgtgagacatcctcctgatcagattgtttggcattatgacaagcgtggggtttatagcgttaagagcggatatcatgtcactagaagactgtccttttcagtatttcaagcatctacctcggtgggacaaccagacttgagggcgttctggaaaaagctttggagggggaatgtccaacctaaggtccgttcctttatttggcgtttagtgtgtggaattatacctaccaaagaagagttgggtaagaaaagagtccaacttcccgagacggttctttctctgccttccgaaaaaaggcttcttgccttacgggtaagggatttggttgtgatctcttcgcatcaccgaatcgatacgggtgcagtcgtaggagaatcccttgacttgacttcttcatcaaacgatgtggacgaggagagcaccaacctcgtcacaaggttcttttctctgccttccgaaaaaaggcttcttgccttacgggtaagggatttggttgtgatctcttcgcatcaccgaatcgatactaaacattgtaggttgagcagagtaatcactgggaagtttggagaaagcaggggtttgctaaagcgtatctttagctttgctgggttgcgagggtgttacccttggttcgctgggttgcaactgggttgcaggtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_1 RVT_3 zf-RVT

Protein Analysis

223

Amino Acids

25.43

Weight (kDa)

10.44

Isoelectric Point (pI)

40.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004835)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g13281
rosa_chinensis	RchiOBHm_Chr1g0356191 RchiOBHm_Chr1g0375381
rosa_laevigata	RLG00000026665
rosa_multiflora	Rmu_sc0000517.1_g000006 Rmu_sc0000554.1_g000042 Rmu_sc0002609.1_g000001 Rmu_sc0021866.1_g000001 Rmu_ssc0000106.1_g000002
rosa_roxburghii	Rroxscaffold_165G00436950 Rroxscaffold_1G00049280 Rroxscaffold_2G00085540 Rroxscaffold_2G00101950 Rroxscaffold_2G00103670 Rroxscaffold_2G00136280 Rroxscaffold_3G00219990 Rroxscaffold_3G00223240 Rroxscaffold_3G00230840 Rroxscaffold_3G00248820 Rroxscaffold_4G00312690 Rroxscaffold_4G00320990 Rroxscaffold_5G00348860 Rroxscaffold_5G00356520 Rroxscaffold_6G00409490 Rroxscaffold_6G00411400 Rroxscaffold_7G00176940
rosa_rugosa	Rorug02G0028800
rosa_samantha	Rh1AG401200 Rh1BG362900 Rh1CG376400 Rh1DG393700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	657
AccBSI	CCGCTC	1 cut(s)	78
AciI	CCGC	1 cut(s)	78
AdeI	CACNNNGTG	1 cut(s)	11
AfiI	CCNNNNNNNGG	4 cut(s)	193, 210, 306, 474
AgsI	TTSAA	1 cut(s)	119
AluBI	AGCT	2 cut(s)	169, 612
AluI	AGCT	2 cut(s)	169, 612
Alw21I	GWGCWC	1 cut(s)	434
Alw26I	GTCTC	2 cut(s)	10, 272
Ama87I	CYCGRG	1 cut(s)	275
AspS9I	GGNCC	1 cut(s)	196
AsuHPI	GGTGA	2 cut(s)	347, 515
AvaI	CYCGRG	1 cut(s)	275
AvaII	GGWCC	1 cut(s)	196
AxyI	CCTNAGG	1 cut(s)	192
BbsI	GAAGAC	1 cut(s)	103
Bbv12I	GWGCWC	1 cut(s)	434
BcgI	CGANNNNNNTGC	6 cut(s)	111, 145, 353, 387, 421, 455
BclI	TGATCA	1 cut(s)	28
BcoDI	GTCTC	2 cut(s)	10, 272
BfaI	CTAG	1 cut(s)	93
BfuAI	ACCTGC	1 cut(s)	657
Bme18I	GGWCC	1 cut(s)	196
BmeT110I	CYCGRG	1 cut(s)	275
BmgT120I	GGNCC	1 cut(s)	196
BmrI	ACTGGG	2 cut(s)	576, 668
BmsI	GCATC	3 cut(s)	131, 361, 529
BmuI	ACTGGG	2 cut(s)	576, 668
BpiI	GAAGAC	1 cut(s)	103
BplI	GAGNNNNNCTC	2 cut(s)	7, 39
BpuEI	CTTGAG	1 cut(s)	169
Bsa29I	ATCGAT	2 cut(s)	363, 531
BsaJI	CCNNGG	2 cut(s)	129, 638
Bsc4I	CCNNNNNNNGG	4 cut(s)	193, 210, 306, 474
Bse1I	ACTGG	2 cut(s)	571, 663
Bse21I	CCTNAGG	1 cut(s)	192
BseCI	ATCGAT	2 cut(s)	363, 531
BseDI	CCNNGG	2 cut(s)	129, 638
BseGI	GGATG	1 cut(s)	19
BseLI	CCNNNNNNNGG	4 cut(s)	193, 210, 306, 474
BseNI	ACTGG	2 cut(s)	571, 663
BseRI	GAGGAG	1 cut(s)	440
BseYI	CCCAGC	2 cut(s)	617, 647
BsgI	GTGCAG	1 cut(s)	393
BshVI	ATCGAT	2 cut(s)	363, 531
BsiHKAI	GWGCWC	1 cut(s)	434
BsiHKCI	CYCGRG	1 cut(s)	275
BslFI	GGGAC	1 cut(s)	150
BslI	CCNNNNNNNGG	4 cut(s)	193, 210, 306, 474
BsmAI	GTCTC	2 cut(s)	10, 272
BsmBI	CGTCTC	1 cut(s)	272
BsmFI	GGGAC	1 cut(s)	150
BsoBI	CYCGRG	1 cut(s)	275
Bsp1286I	GDGCHC	1 cut(s)	434
Bsp143I	GATC	3 cut(s)	28, 342, 510
BspACI	CCGC	1 cut(s)	78
BspDI	ATCGAT	2 cut(s)	363, 531
BspMI	ACCTGC	1 cut(s)	657
BsrBI	CCGCTC	1 cut(s)	78
BsrI	ACTGG	2 cut(s)	571, 663
BssECI	CCNNGG	2 cut(s)	129, 638
BssMI	GATC	3 cut(s)	28, 342, 510
BssT1I	CCWWGG	1 cut(s)	638
Bst4CI	ACNGT	2 cut(s)	102, 283
Bst6I	CTCTTC	3 cut(s)	240, 352, 520
BstDEI	CTNAG	2 cut(s)	8, 192
BstF5I	GGATG	1 cut(s)	19
BstKTI	GATC	3 cut(s)	31, 345, 513
BstMAI	GTCTC	2 cut(s)	10, 272
BstMBI	GATC	3 cut(s)	28, 342, 510
BstMWI	GCNNNNNNNGC	1 cut(s)	75
BstV2I	GAAGAC	1 cut(s)	103
Bsu15I	ATCGAT	2 cut(s)	363, 531
Bsu36I	CCTNAGG	1 cut(s)	192
BsuTUI	ATCGAT	2 cut(s)	363, 531
BtsCI	GGATG	1 cut(s)	19
BtsIMutI	CAGTG	1 cut(s)	564
BveI	ACCTGC	1 cut(s)	657
Cfr13I	GGNCC	1 cut(s)	196
ClaI	ATCGAT	2 cut(s)	363, 531
CspCI	CAANNNNNGTGG	2 cut(s)	399, 434
CviAII	CATG	1 cut(s)	86
CviJI	RGCY	4 cut(s)	169, 310, 478, 612
CviKI_1	RGCY	4 cut(s)	169, 310, 478, 612
DdeI	CTNAG	2 cut(s)	8, 192
DpnI	GATC	3 cut(s)	30, 344, 512
DpnII	GATC	3 cut(s)	28, 342, 510
DraIII	CACNNNGTG	1 cut(s)	11
Eam1104I	CTCTTC	3 cut(s)	240, 352, 520
EarI	CTCTTC	3 cut(s)	240, 352, 520
Eco130I	CCWWGG	1 cut(s)	638
Eco32I	GATATC	1 cut(s)	83
Eco47I	GGWCC	1 cut(s)	196
Eco81I	CCTNAGG	1 cut(s)	192
Eco88I	CYCGRG	1 cut(s)	275
EcoRV	GATATC	1 cut(s)	83
EcoT14I	CCWWGG	1 cut(s)	638
ErhI	CCWWGG	1 cut(s)	638
Esp3I	CGTCTC	1 cut(s)	272
FaeI	CATG	1 cut(s)	89
FaiI	YATR	4 cut(s)	48, 66, 87, 233
FalI	AAGNNNNNCTT	2 cut(s)	590, 622
FaqI	GGGAC	1 cut(s)	150
FatI	CATG	1 cut(s)	85
FbaI	TGATCA	1 cut(s)	28
FokI	GGATG	1 cut(s)	6
FspBI	CTAG	1 cut(s)	93
GsaI	CCCAGC	2 cut(s)	621, 651
Hin1II	CATG	1 cut(s)	89
HindIII	AAGCTT	1 cut(s)	167
HinfI	GANTC	4 cut(s)	264, 360, 386, 528
HphI	GGTGA	2 cut(s)	347, 515
Hpy166II	GTNNAC	1 cut(s)	421
Hpy188I	TCNGA	3 cut(s)	33, 301, 469
Hpy188III	TCNNGA	3 cut(s)	26, 160, 275
Hpy8I	GTNNAC	1 cut(s)	421
HpyAV	CCTTC	2 cut(s)	306, 474
HpyCH4III	ACNGT	2 cut(s)	102, 283
HpyCH4V	TGCA	3 cut(s)	374, 655, 666
HpyF10VI	GCNNNNNNNGC	1 cut(s)	75
HpyF3I	CTNAG	2 cut(s)	8, 192
Hsp92II	CATG	1 cut(s)	89
Ksp22I	TGATCA	1 cut(s)	28
Kzo9I	GATC	3 cut(s)	28, 342, 510
LpnPI	CCDG	9 cut(s)	39, 145, 156, 552, 571, 603, 633, 644, 652
LweI	GCATC	3 cut(s)	131, 361, 529
MaeI	CTAG	1 cut(s)	93
MaeIII	GTNAC	3 cut(s)	88, 442, 632
MalI	GATC	3 cut(s)	30, 344, 512
MbiI	CCGCTC	1 cut(s)	78
MboI	GATC	3 cut(s)	28, 342, 510
MboII	GAAGA	5 cut(s)	108, 257, 339, 396, 507
MhlI	GDGCHC	1 cut(s)	434
MluCI	AATT	1 cut(s)	228
MlyI	GAGTC	1 cut(s)	273
MmeI	TCCRAC	2 cut(s)	211, 292
MnlI	CCTC	7 cut(s)	33, 139, 144, 168, 418, 449, 620
MseI	TTAA	1 cut(s)	72
MwoI	GCNNNNNNNGC	1 cut(s)	75
NdeII	GATC	3 cut(s)	28, 342, 510
NlaIII	CATG	1 cut(s)	89
NmuCI	GTSAC	2 cut(s)	88, 442
PcsI	WCGNNNNNNNCGW	1 cut(s)	420
PfeI	GAWTC	3 cut(s)	360, 386, 528
PleI	GAGTC	1 cut(s)	272
PpsI	GAGTC	1 cut(s)	272
PspFI	CCCAGC	2 cut(s)	617, 647
PspPI	GGNCC	1 cut(s)	196
SaqAI	TTAA	1 cut(s)	72
Sau3AI	GATC	3 cut(s)	28, 342, 510
Sau96I	GGNCC	1 cut(s)	196
SchI	GAGTC	1 cut(s)	273
SduI	GDGCHC	1 cut(s)	434
SfaNI	GCATC	3 cut(s)	131, 361, 529
SinI	GGWCC	1 cut(s)	196
SmlI	CTYRAG	1 cut(s)	148
SmoI	CTYRAG	1 cut(s)	148
Sse9I	AATT	1 cut(s)	228
SsiI	CCGC	1 cut(s)	78
SspMI	CTAG	1 cut(s)	93
StyI	CCWWGG	1 cut(s)	638
TaaI	ACNGT	2 cut(s)	102, 283
TaqI	TCGA	2 cut(s)	363, 531
TasI	AATT	1 cut(s)	228
TfiI	GAWTC	3 cut(s)	360, 386, 528
Tru1I	TTAA	1 cut(s)	72
Tru9I	TTAA	1 cut(s)	72
TscAI	CASTG	1 cut(s)	571
TseFI	GTSAC	2 cut(s)	88, 442
Tsp45I	GTSAC	2 cut(s)	88, 442
TspDTI	ATGAA	1 cut(s)	396
TspGWI	ACGGA	1 cut(s)	188
TspRI	CASTG	1 cut(s)	571
VpaK11BI	GGWCC	1 cut(s)	196
XcmI	CCANNNNNNNNNTGG	1 cut(s)	247
XspI	CTAG	1 cut(s)	93

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.