Rh1DG393700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
61162106 .. 61162420
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG393700.1

Sequence Viewer

Length: 315 bp
ATGACAAAGATATGTGGAGGTCAACTTGAAGATAATGGAAGTCTGAAGCCACTCTCTGATGATTTCTCGTTGGTTTTCAAAACGAGAACCAACAATAAGGAGAAATCTAACAATCCTTTGCGGAGGCCGGTTTTCAATAACCAAGAATGGGAAGTCCTCTTCAAGAATGTGAATGATGAGGATACGACATTGACTGTCACTCTTCCAAAAACTCGTGAGGGGATGAAACGTGATCATCCTTTAAGGAAGCCGATTGAAAATAATGAGCAATGGAGCGCCCTCAAAGAAAGAAAATTGGAGCTAGAAACCCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

104

Amino Acids

12.16

Weight (kDa)

7.85

Isoelectric Point (pI)

26.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 121
AcuI CTGAAG 1 cut(s) 65
AfiI CCNNNNNNNGG 1 cut(s) 148
AgsI TTSAA 5 cut(s) 29, 79, 136, 163, 257
AluBI AGCT 1 cut(s) 301
AluI AGCT 1 cut(s) 301
AoxI GGCC 1 cut(s) 125
AspLEI GCGC 1 cut(s) 278
BauI CACGAG 1 cut(s) 213
BciVI GTATCC 1 cut(s) 175
BclI TGATCA 1 cut(s) 232
BfaI CTAG 1 cut(s) 302
BfoI RGCGCY 1 cut(s) 279
BfuI GTATCC 1 cut(s) 175
Bsc4I CCNNNNNNNGG 1 cut(s) 148
Bse118I RCCGGY 1 cut(s) 127
Bse3DI GCAATG 1 cut(s) 275
BseGI GGATG 2 cut(s) 228, 235
BseLI CCNNNNNNNGG 1 cut(s) 148
BseMI GCAATG 1 cut(s) 275
BshFI GGCC 1 cut(s) 127
BsiSI CCGG 1 cut(s) 128
BslI CCNNNNNNNGG 1 cut(s) 148
BsnI GGCC 1 cut(s) 127
Bsp143I GATC 1 cut(s) 232
BspACI CCGC 1 cut(s) 121
BspANI GGCC 1 cut(s) 127
BsrDI GCAATG 1 cut(s) 275
BsrFI RCCGGY 1 cut(s) 127
BssAI RCCGGY 1 cut(s) 127
BssMI GATC 1 cut(s) 232
BssSI CACGAG 1 cut(s) 213
Bst2BI CACGAG 1 cut(s) 213
Bst4CI ACNGT 1 cut(s) 196
Bst6I CTCTTC 2 cut(s) 164, 207
BstF5I GGATG 2 cut(s) 228, 235
BstH2I RGCGCY 1 cut(s) 279
BstHHI GCGC 1 cut(s) 278
BstKTI GATC 1 cut(s) 235
BstMBI GATC 1 cut(s) 232
BsuI GTATCC 1 cut(s) 175
BsuRI GGCC 1 cut(s) 127
BtsCI GGATG 2 cut(s) 228, 235
CfoI GCGC 1 cut(s) 278
Cfr10I RCCGGY 1 cut(s) 127
CviJI RGCY 4 cut(s) 49, 127, 250, 301
CviKI_1 RGCY 4 cut(s) 49, 127, 250, 301
DpnI GATC 1 cut(s) 234
DpnII GATC 1 cut(s) 232
Eam1104I CTCTTC 2 cut(s) 164, 207
EarI CTCTTC 2 cut(s) 164, 207
Eco57I CTGAAG 1 cut(s) 65
FaiI YATR 1 cut(s) 13
FbaI TGATCA 1 cut(s) 232
FokI GGATG 2 cut(s) 222, 235
FspBI CTAG 1 cut(s) 302
GlaI GCGC 1 cut(s) 277
HaeII RGCGCY 1 cut(s) 279
HaeIII GGCC 1 cut(s) 127
HapII CCGG 1 cut(s) 128
HhaI GCGC 1 cut(s) 278
Hin6I GCGC 1 cut(s) 276
HinP1I GCGC 1 cut(s) 276
HincII GTYRAC 1 cut(s) 23
HindII GTYRAC 1 cut(s) 23
HpaII CCGG 1 cut(s) 128
Hpy166II GTNNAC 1 cut(s) 23
Hpy188I TCNGA 2 cut(s) 45, 58
Hpy188III TCNNGA 2 cut(s) 163, 215
Hpy8I GTNNAC 1 cut(s) 23
HpyCH4III ACNGT 1 cut(s) 196
HpyCH4IV ACGT 1 cut(s) 229
HpySE526I ACGT 1 cut(s) 229
HspAI GCGC 1 cut(s) 276
Ksp22I TGATCA 1 cut(s) 232
Kzo9I GATC 1 cut(s) 232
LmnI GCTCC 2 cut(s) 273, 298
LpnPI CCDG 1 cut(s) 141
MaeI CTAG 1 cut(s) 302
MaeII ACGT 1 cut(s) 229
MaeIII GTNAC 1 cut(s) 196
MalI GATC 1 cut(s) 234
MboI GATC 1 cut(s) 232
MboII GAAGA 3 cut(s) 41, 151, 194
MluCI AATT 1 cut(s) 293
MnlI CCTC 6 cut(s) 11, 117, 167, 172, 211, 290
MseI TTAA 1 cut(s) 242
MspI CCGG 1 cut(s) 128
NdeII GATC 1 cut(s) 232
NmuCI GTSAC 1 cut(s) 196
SaqAI TTAA 1 cut(s) 242
Sau3AI GATC 1 cut(s) 232
SetI ASST 3 cut(s) 22, 232, 303
SgeI CNNG 9 cut(s) 38, 79, 96, 140, 155, 175, 225, 227, 242
Sse9I AATT 1 cut(s) 293
SsiI CCGC 1 cut(s) 121
SspMI CTAG 1 cut(s) 302
TaaI ACNGT 1 cut(s) 196
TaiI ACGT 1 cut(s) 232
TasI AATT 1 cut(s) 293
Tru1I TTAA 1 cut(s) 242
Tru9I TTAA 1 cut(s) 242
TseFI GTSAC 1 cut(s) 196
Tsp45I GTSAC 1 cut(s) 196
TspDTI ATGAA 1 cut(s) 239
XspI CTAG 1 cut(s) 302
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.