Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002923.1

Orthogroup ID

OG0002594

Physical Location & Seq

Genomic Coordinates Reverse (-)

5266 .. 7626

Gene Structure 2361 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002923.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1083 bp

atggcacccagttttgactgtgcagtttcaagcctgctttgcgcagaagacaaccttttttatgataatgattttgggtctttgagggttgaggttgagtctgaggaggttacttggaatcgtcacagaaacaataatcaaaaccggggctttgataatgatgaagaagacgggctgccattgcagagtagtgatgagtatttggcttctattattgaaaaggaatcacaccacttgcctcgtgttgattacttgaagagattgcaaagtggggatttggaccttggggctagaaatgaggctgttgattggattcaaaaggcaaattcccatttcagctttggacctctgtgtcaatatctatctgtaagctacttggatcgcttcctttcggcctatgaaatacctaatggcaaagcttggactatgcaattgttggcagtggcatgtttgtccctcgcagccaaaatggacgagattgctgtcccactctctcttgatttacaggtggccgagtcaaaatatgtatttgaggctagaactattcaaagaatggagctactggtcttgagcacattgagatggagaatgcaagcagttactccaatctcattcatagattccttcctagtcaagctcaatgaggacaaaatcccacttaaagcttcaatctttagagcagttcaactcatattgagcacaaccaagggaattgacttcttggaatttaaaccatcagaggttgcagcagcagtggccatatctgtagcaggagaaagcaaagcattggatgacactcagaaagcaatctctgtgctcatccaacatgtcgacttagaaaaggagagagtggtaaagtgtgtaaatttgattcaagatgttggattaatgagtggggccttcaagaatggtagtggttcagtgcagtctgtgccacaaagccccattggggtgttggatgttgcatgcttcagctataaaagtgatgatcacaccacagttgggtcatgtgcaaattcttttcataatggctcagacaccaaaagaaggaagctaaacagaccctatgaagtggagttatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cyclin_C Cyclin_N

Protein Analysis

360

Amino Acids

40.11

Weight (kDa)

5.02

Isoelectric Point (pI)

39.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002594)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G22490 AT2G22490 AT5G10440 AT5G10440 AT5G65420 AT5G65420 AT5G65420 AT5G65420
fragaria_vesca	FvH4_1g19970 FvH4_5g35800
malus_domestica	MD01G1037500.v1.1 MD08G1193300.v1.1 MD15G1315400.v1.1 MD15G1381900.v1.1
prunus_persica	Prupe.1G527900_v2.0.a1 Prupe.6G196300_v2.0.a1 Prupe.6G196300_v2.0.a1 Prupe.6G196300_v2.0.a1
pyrus_communis	pycom01g06540 pycom15g27860
rosa_chinensis	RchiOBHm_Chr2g0111911 RchiOBHm_Chr7g0237481
rosa_laevigata	RLG00000000999 RLG00000017937
rosa_multiflora	Rmu_sc0002923.1_g000002 Rmu_sc0006833.1_g000001
rosa_roxburghii	Rroxscaffold_2G00132000 Rroxscaffold_3G00224140
rosa_rugosa	Rorug02G0177000 Rorug07G0303700
rosa_samantha	Rh2AG229400 Rh2BG242100 Rh2BG242200 Rh2CG233500 Rh2DG237100 Rh7BG430900 Rh7CG478300 Rh7DG447600
rosa_wichuraiana	Rw2G017750 Rw7G038150

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	351
Acc16I	TGCGCA	1 cut(s)	43
AccB1I	GGYRCC	1 cut(s)	4
AccI	GTMKAC	1 cut(s)	831
AclWI	GGATC	1 cut(s)	387
AcoI	YGGCCR	2 cut(s)	510, 756
AcsI	RAATTY	4 cut(s)	325, 725, 865, 1015
AcuI	CTGAAG	1 cut(s)	955
AfiI	CCNNNNNNNGG	3 cut(s)	949, 1002, 1047
AflIII	ACRYGT	1 cut(s)	826
AgsI	TTSAA	9 cut(s)	30, 218, 256, 317, 548, 669, 686, 875, 904
AluBI	AGCT	8 cut(s)	339, 372, 419, 559, 637, 665, 975, 1054
AluI	AGCT	8 cut(s)	339, 372, 419, 559, 637, 665, 975, 1054
Alw21I	GWGCWC	3 cut(s)	575, 701, 819
AlwI	GGATC	1 cut(s)	387
AoxI	GGCC	4 cut(s)	393, 510, 756, 897
ApeKI	GCWGC	4 cut(s)	175, 461, 746, 749
ApoI	RAATTY	4 cut(s)	325, 725, 865, 1015
AseI	ATTAAT	1 cut(s)	887
AspLEI	GCGC	1 cut(s)	44
AspS9I	GGNCC	3 cut(s)	280, 344, 897
AsuC2I	CCSGG	1 cut(s)	146
AvaII	GGWCC	2 cut(s)	280, 344
BalI	TGGCCA	1 cut(s)	758
BanI	GGYRCC	1 cut(s)	4
BauI	CACGAG	1 cut(s)	240
BbsI	GAAGAC	2 cut(s)	54, 174
Bbv12I	GWGCWC	3 cut(s)	575, 701, 819
BbvI	GCAGC	4 cut(s)	162, 473, 758, 761
BccI	CCATC	2 cut(s)	576, 742
BclI	TGATCA	1 cut(s)	988
BcnI	CCSGG	1 cut(s)	146
BfaI	CTAG	3 cut(s)	291, 537, 629
BfmI	CTRYAG	1 cut(s)	765
BisI	GCNGC	4 cut(s)	176, 462, 747, 750
BlsI	GCNGC	4 cut(s)	177, 463, 748, 751
Bme1390I	CCNGG	1 cut(s)	146
Bme18I	GGWCC	2 cut(s)	280, 344
BmgT120I	GGNCC	3 cut(s)	280, 344, 897
BmiI	GGNNCC	2 cut(s)	6, 898
BmrFI	CCNGG	1 cut(s)	146
BmrI	ACTGGG	1 cut(s)	3
BmuI	ACTGGG	1 cut(s)	3
BpiI	GAAGAC	2 cut(s)	54, 174
BpuEI	CTTGAG	1 cut(s)	589
BpuMI	CCSGG	1 cut(s)	146
BsaJI	CCNNGG	3 cut(s)	145, 283, 705
Bsc4I	CCNNNNNNNGG	3 cut(s)	949, 1002, 1047
Bse1I	ACTGG	2 cut(s)	9, 567
Bse3DI	GCAATG	1 cut(s)	179
BseDI	CCNNGG	3 cut(s)	145, 283, 705
BseGI	GGATG	3 cut(s)	796, 819, 964
BseLI	CCNNNNNNNGG	3 cut(s)	949, 1002, 1047
BseMI	GCAATG	1 cut(s)	179
BseMII	CTCAG	3 cut(s)	93, 812, 1047
BseNI	ACTGG	2 cut(s)	9, 567
BseRI	GAGGAG	1 cut(s)	119
BseXI	GCAGC	4 cut(s)	162, 473, 758, 761
BsgI	GTGCAG	2 cut(s)	42, 944
BshFI	GGCC	4 cut(s)	395, 512, 758, 899
BshNI	GGYRCC	1 cut(s)	4
BsiHKAI	GWGCWC	3 cut(s)	575, 701, 819
BsiSI	CCGG	1 cut(s)	145
BslFI	GGGAC	2 cut(s)	439, 470
BslI	CCNNNNNNNGG	3 cut(s)	949, 1002, 1047
BsmFI	GGGAC	2 cut(s)	439, 470
BsmI	GAATGC	1 cut(s)	594
BsnI	GGCC	4 cut(s)	395, 512, 758, 899
Bsp1286I	GDGCHC	3 cut(s)	575, 701, 819
Bsp143I	GATC	2 cut(s)	379, 988
BspANI	GGCC	4 cut(s)	395, 512, 758, 899
BspCNI	CTCAG	3 cut(s)	94, 811, 1046
BspLI	GGNNCC	2 cut(s)	6, 898
BspPI	GGATC	1 cut(s)	387
BspT107I	GGYRCC	1 cut(s)	4
BsrDI	GCAATG	1 cut(s)	179
BsrI	ACTGG	2 cut(s)	9, 567
BssECI	CCNNGG	3 cut(s)	145, 283, 705
BssMI	GATC	2 cut(s)	379, 988
BssSI	CACGAG	1 cut(s)	240
BssT1I	CCWWGG	2 cut(s)	283, 705
Bst2BI	CACGAG	1 cut(s)	240
Bst4CI	ACNGT	2 cut(s)	20, 1000
Bst6I	CTCTTC	1 cut(s)	251
BstAPI	GCANNNNNTGC	1 cut(s)	931
BstC8I	GCNNGC	3 cut(s)	35, 594, 967
BstDEI	CTNAG	4 cut(s)	102, 798, 835, 1033
BstF5I	GGATG	3 cut(s)	796, 819, 964
BstHHI	GCGC	1 cut(s)	44
BstKTI	GATC	2 cut(s)	382, 991
BstMBI	GATC	2 cut(s)	379, 988
BstMWI	GCNNNNNNNGC	4 cut(s)	39, 181, 755, 931
BstNSI	RCATGY	3 cut(s)	450, 830, 969
BstSCI	CCNGG	1 cut(s)	144
BstSFI	CTRYAG	1 cut(s)	765
BstV1I	GCAGC	4 cut(s)	162, 473, 758, 761
BstV2I	GAAGAC	2 cut(s)	54, 174
BsuRI	GGCC	4 cut(s)	395, 512, 758, 899
BtsCI	GGATG	3 cut(s)	796, 819, 964
BtsI	GCAGTG	2 cut(s)	447, 759
BtsIMutI	CAGTG	3 cut(s)	447, 759, 927
Cac8I	GCNNGC	3 cut(s)	35, 594, 967
CfoI	GCGC	1 cut(s)	44
Cfr13I	GGNCC	3 cut(s)	280, 344, 897
CviAII	CATG	4 cut(s)	447, 827, 966, 1008
DdeI	CTNAG	4 cut(s)	102, 798, 835, 1033
DpnI	GATC	2 cut(s)	381, 990
DpnII	GATC	2 cut(s)	379, 988
DraI	TTTAAA	1 cut(s)	730
DrdI	GACNNNNNNGTC	1 cut(s)	351
DseDI	GACNNNNNNGTC	1 cut(s)	351
EaeI	YGGCCR	2 cut(s)	510, 756
Eam1104I	CTCTTC	1 cut(s)	251
EarI	CTCTTC	1 cut(s)	251
Eco130I	CCWWGG	2 cut(s)	283, 705
Eco47I	GGWCC	2 cut(s)	280, 344
Eco57I	CTGAAG	1 cut(s)	955
EcoO109I	RGGNCCY	1 cut(s)	897
EcoT14I	CCWWGG	2 cut(s)	283, 705
ErhI	CCWWGG	2 cut(s)	283, 705
FaeI	CATG	4 cut(s)	450, 830, 969, 1011
FalI	AAGNNNNNCTT	2 cut(s)	39, 71
FaqI	GGGAC	2 cut(s)	439, 470
FatI	CATG	4 cut(s)	446, 826, 965, 1007
FbaI	TGATCA	1 cut(s)	988
FblI	GTMKAC	1 cut(s)	831
Fnu4HI	GCNGC	4 cut(s)	176, 462, 747, 750
FokI	GGATG	3 cut(s)	803, 806, 971
Fsp4HI	GCNGC	4 cut(s)	176, 462, 747, 750
FspBI	CTAG	3 cut(s)	291, 537, 629
FspI	TGCGCA	1 cut(s)	43
GlaI	GCGC	1 cut(s)	43
GluI	GCNGC	4 cut(s)	176, 462, 747, 750
HaeIII	GGCC	4 cut(s)	395, 512, 758, 899
HapII	CCGG	1 cut(s)	145
HhaI	GCGC	1 cut(s)	44
Hin1II	CATG	4 cut(s)	450, 830, 969, 1011
Hin6I	GCGC	1 cut(s)	42
HinP1I	GCGC	1 cut(s)	42
HincII	GTYRAC	1 cut(s)	832
HindII	GTYRAC	1 cut(s)	832
HindIII	AAGCTT	2 cut(s)	417, 663
HinfI	GANTC	7 cut(s)	98, 118, 224, 313, 515, 620, 871
HpaII	CCGG	1 cut(s)	145
Hpy166II	GTNNAC	1 cut(s)	832
Hpy188I	TCNGA	4 cut(s)	103, 739, 801, 1036
Hpy188III	TCNNGA	4 cut(s)	497, 568, 875, 904
Hpy8I	GTNNAC	1 cut(s)	832
HpyAV	CCTTC	3 cut(s)	634, 910, 1041
HpyCH4III	ACNGT	2 cut(s)	20, 1000
HpyCH4V	TGCA	9 cut(s)	23, 184, 265, 430, 592, 746, 925, 965, 1013
HpyF10VI	GCNNNNNNNGC	4 cut(s)	39, 181, 755, 931
HpyF3I	CTNAG	4 cut(s)	102, 798, 835, 1033
Hsp92II	CATG	4 cut(s)	450, 830, 969, 1011
HspAI	GCGC	1 cut(s)	42
Ksp22I	TGATCA	1 cut(s)	988
Kzo9I	GATC	2 cut(s)	379, 988
LmnI	GCTCC	1 cut(s)	556
LpnPI	CCDG	6 cut(s)	22, 47, 158, 491, 548, 756
Lsp1109I	GCAGC	4 cut(s)	162, 473, 758, 761
MaeI	CTAG	3 cut(s)	291, 537, 629
MaeIII	GTNAC	3 cut(s)	109, 122, 598
MalI	GATC	2 cut(s)	381, 990
MboI	GATC	2 cut(s)	379, 988
MboII	GAAGA	4 cut(s)	59, 176, 179, 268
MfeI	CAATTG	1 cut(s)	431
MhlI	GDGCHC	3 cut(s)	575, 701, 819
MlsI	TGGCCA	1 cut(s)	758
MluCI	AATT	6 cut(s)	325, 431, 711, 725, 865, 1015
MluNI	TGGCCA	1 cut(s)	758
MlyI	GAGTC	2 cut(s)	107, 524
MmeI	TCCRAC	3 cut(s)	847, 862, 936
Mox20I	TGGCCA	1 cut(s)	758
MscI	TGGCCA	1 cut(s)	758
MseI	TTAA	3 cut(s)	660, 729, 887
MslI	CAYNNNNRTG	2 cut(s)	580, 950
Msp20I	TGGCCA	1 cut(s)	758
MspI	CCGG	1 cut(s)	145
MspR9I	CCNGG	1 cut(s)	146
MunI	CAATTG	1 cut(s)	431
Mva1269I	GAATGC	1 cut(s)	594
MwoI	GCNNNNNNNGC	4 cut(s)	39, 181, 755, 931
NciI	CCSGG	1 cut(s)	146
NdeII	GATC	2 cut(s)	379, 988
NlaIII	CATG	4 cut(s)	450, 830, 969, 1011
NlaIV	GGNNCC	2 cut(s)	6, 898
NmeAIII	GCCGAG	1 cut(s)	538
NmuCI	GTSAC	1 cut(s)	122
NsbI	TGCGCA	1 cut(s)	43
NspI	RCATGY	3 cut(s)	450, 830, 969
PaeI	GCATGC	1 cut(s)	969
PciI	ACATGT	1 cut(s)	826
PctI	GAATGC	1 cut(s)	594
PfeI	GAWTC	5 cut(s)	118, 224, 313, 620, 871
PkrI	GCNGC	4 cut(s)	177, 463, 748, 751
PleI	GAGTC	2 cut(s)	106, 523
PpsI	GAGTC	2 cut(s)	106, 523
PscI	ACATGT	1 cut(s)	826
PshBI	ATTAAT	1 cut(s)	887
PspN4I	GGNNCC	2 cut(s)	6, 898
PspPI	GGNCC	3 cut(s)	280, 344, 897
RseI	CAYNNNNRTG	2 cut(s)	580, 950
SalI	GTCGAC	1 cut(s)	830
SaqAI	TTAA	3 cut(s)	660, 729, 887
SatI	GCNGC	4 cut(s)	176, 462, 747, 750
Sau3AI	GATC	2 cut(s)	379, 988
Sau96I	GGNCC	3 cut(s)	280, 344, 897
SchI	GAGTC	2 cut(s)	107, 524
ScrFI	CCNGG	1 cut(s)	146
SduI	GDGCHC	3 cut(s)	575, 701, 819
SfcI	CTRYAG	1 cut(s)	765
SinI	GGWCC	2 cut(s)	280, 344
SmiMI	CAYNNNNRTG	2 cut(s)	580, 950
SmlI	CTYRAG	1 cut(s)	568
SmoI	CTYRAG	1 cut(s)	568
SphI	GCATGC	1 cut(s)	969
Sse9I	AATT	6 cut(s)	325, 431, 711, 725, 865, 1015
SspMI	CTAG	3 cut(s)	291, 537, 629
StyD4I	CCNGG	1 cut(s)	144
StyI	CCWWGG	2 cut(s)	283, 705
TaaI	ACNGT	2 cut(s)	20, 1000
TaqI	TCGA	1 cut(s)	831
TasI	AATT	6 cut(s)	325, 431, 711, 725, 865, 1015
TfiI	GAWTC	5 cut(s)	118, 224, 313, 620, 871
Tru1I	TTAA	3 cut(s)	660, 729, 887
Tru9I	TTAA	3 cut(s)	660, 729, 887
TscAI	CASTG	3 cut(s)	447, 759, 927
TseFI	GTSAC	1 cut(s)	122
TseI	GCWGC	4 cut(s)	175, 461, 746, 749
Tsp45I	GTSAC	1 cut(s)	122
TspDTI	ATGAA	5 cut(s)	177, 414, 604, 1013, 1083
TspRI	CASTG	3 cut(s)	447, 759, 927
VpaK11BI	GGWCC	2 cut(s)	280, 344
VspI	ATTAAT	1 cut(s)	887
XapI	RAATTY	4 cut(s)	325, 725, 865, 1015
XceI	RCATGY	3 cut(s)	450, 830, 969
XcmI	CCANNNNNNNNNTGG	2 cut(s)	338, 952
XmiI	GTMKAC	1 cut(s)	831
XspI	CTAG	3 cut(s)	291, 537, 629

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.