Rmu_sc0003069.1_g000006

Belongs to the universal ribosomal protein uL1 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003069.1
Physical Location & Seq
Reverse (-)
33616 .. 34700
1085 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003069.1_g000006.1.cds

Sequence Viewer

Length: 543 bp
atgaagaactatgacccacaaaaggacaagcgtttcagtggttccgtgaagcttccccacattcctcgtcctaagatgagggtttgcatgcttggagatgctcagcatgttgaagaggcagagaagatgggattggcctacatggatgtggaatcgctgaaaaagcttaacaagaacaagaagctggtcaagaagcttgcaaagaagtatcatgcttttttggcttctgaagctgtcatcaagcaaattcctcgtcttttgggccctggtcttaacaaggcaggtaaatttccaactctggtgagtcaccaggaatctctggaggcaaagcttaatgaaacaaaggccatggttaagttccaactaaagaaggttctttgtatgggtgttgccgtcgggaatcttgccatggatgagaaacagatattccagaatgtgcaactcagtgtcaatttcttggtttctctgttgaagaagaattggcagaatgtgagatcattgaacttgaaaagcaccatggggaaagctatccgaatttactaa

Protein Analysis

180

Amino Acids

20.41

Weight (kDa)

10.06

Isoelectric Point (pI)

34.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 272
AcsI RAATTY 3 cut(s) 246, 287, 534
AcuI CTGAAG 1 cut(s) 249
AfiI CCNNNNNNNGG 1 cut(s) 22
AgsI TTSAA 4 cut(s) 113, 472, 502, 508
AjnI CCWGG 2 cut(s) 265, 309
AjuI GAANNNNNNNTTGG 2 cut(s) 116, 148
AluBI AGCT 7 cut(s) 52, 166, 184, 196, 233, 331, 527
AluI AGCT 7 cut(s) 52, 166, 184, 196, 233, 331, 527
AoxI GGCC 3 cut(s) 135, 262, 345
ApaI GGGCCC 1 cut(s) 266
ApoI RAATTY 3 cut(s) 246, 287, 534
ArsI GACNNNNNNTTYG 2 cut(s) 238, 270
AspS9I GGNCC 2 cut(s) 262, 263
AsuHPI GGTGA 2 cut(s) 299, 313
BaeGI GKGCMC 1 cut(s) 266
BanII GRGCYC 1 cut(s) 266
BccI CCATC 1 cut(s) 121
BceAI ACGGC 1 cut(s) 377
BcgI CGANNNNNNTGC 2 cut(s) 233, 267
BciT130I CCWGG 2 cut(s) 267, 311
BfuAI ACCTGC 1 cut(s) 272
BlpI GCTNAGC 1 cut(s) 102
Bme1390I CCNGG 2 cut(s) 267, 311
BmgT120I GGNCC 2 cut(s) 262, 263
BmiI GGNNCC 2 cut(s) 43, 264
BmrFI CCNGG 2 cut(s) 267, 311
BmsI GCATC 1 cut(s) 88
BpmI CTGGAG 1 cut(s) 341
Bpu1102I GCTNAGC 1 cut(s) 102
BsaJI CCNNGG 4 cut(s) 265, 348, 408, 516
Bsc4I CCNNNNNNNGG 1 cut(s) 22
BseBI CCWGG 2 cut(s) 267, 311
BseDI CCNNGG 4 cut(s) 265, 348, 408, 516
BseGI GGATG 2 cut(s) 151, 418
BseLI CCNNNNNNNGG 1 cut(s) 22
BseMII CTCAG 2 cut(s) 116, 457
BseSI GKGCMC 1 cut(s) 266
BshFI GGCC 3 cut(s) 137, 264, 347
BslI CCNNNNNNNGG 1 cut(s) 22
BsnI GGCC 3 cut(s) 137, 264, 347
Bsp120I GGGCCC 1 cut(s) 262
Bsp1286I GDGCHC 1 cut(s) 266
Bsp143I GATC 1 cut(s) 494
Bsp1720I GCTNAGC 1 cut(s) 102
Bsp19I CCATGG 3 cut(s) 348, 408, 516
BspANI GGCC 3 cut(s) 137, 264, 347
BspCNI CTCAG 2 cut(s) 115, 456
BspLI GGNNCC 2 cut(s) 43, 264
BspMI ACCTGC 1 cut(s) 272
BssECI CCNNGG 4 cut(s) 265, 348, 408, 516
BssMI GATC 1 cut(s) 494
BssT1I CCWWGG 3 cut(s) 348, 408, 516
Bst2UI CCWGG 2 cut(s) 267, 311
Bst6I CTCTTC 1 cut(s) 108
BstC8I GCNNGC 2 cut(s) 89, 198
BstDEI CTNAG 3 cut(s) 72, 102, 443
BstDSI CCRYGG 3 cut(s) 348, 408, 516
BstF5I GGATG 2 cut(s) 151, 418
BstKTI GATC 1 cut(s) 497
BstMBI GATC 1 cut(s) 494
BstMWI GCNNNNNNNGC 3 cut(s) 163, 221, 230
BstNI CCWGG 2 cut(s) 267, 311
BstNSI RCATGY 2 cut(s) 91, 110
BstSCI CCNGG 2 cut(s) 265, 309
BstSLI GKGCMC 1 cut(s) 266
BsuRI GGCC 3 cut(s) 137, 264, 347
BtgI CCRYGG 3 cut(s) 348, 408, 516
BtsCI GGATG 2 cut(s) 151, 418
BtsIMutI CAGTG 2 cut(s) 43, 451
BveI ACCTGC 1 cut(s) 272
Cac8I GCNNGC 2 cut(s) 89, 198
Cfr13I GGNCC 2 cut(s) 262, 263
CviAII CATG 7 cut(s) 88, 107, 142, 212, 349, 409, 517
DdeI CTNAG 3 cut(s) 72, 102, 443
DpnI GATC 1 cut(s) 496
DpnII GATC 1 cut(s) 494
Eam1104I CTCTTC 1 cut(s) 108
EarI CTCTTC 1 cut(s) 108
Eco130I CCWWGG 3 cut(s) 348, 408, 516
Eco24I GRGCYC 1 cut(s) 266
Eco57I CTGAAG 1 cut(s) 249
EcoO109I RGGNCCY 1 cut(s) 263
EcoRII CCWGG 2 cut(s) 265, 309
EcoT14I CCWWGG 3 cut(s) 348, 408, 516
EcoT38I GRGCYC 1 cut(s) 266
ErhI CCWWGG 3 cut(s) 348, 408, 516
FaeI CATG 7 cut(s) 91, 110, 145, 215, 352, 412, 520
FaiI YATR 9 cut(s) 12, 89, 108, 143, 213, 350, 383, 410, 518
FatI CATG 7 cut(s) 87, 106, 141, 211, 348, 408, 516
FokI GGATG 2 cut(s) 158, 425
FriOI GRGCYC 1 cut(s) 266
GsuI CTGGAG 1 cut(s) 341
HaeIII GGCC 3 cut(s) 137, 264, 347
Hin1II CATG 7 cut(s) 91, 110, 145, 215, 352, 412, 520
HindIII AAGCTT 4 cut(s) 50, 164, 194, 329
HinfI GANTC 4 cut(s) 152, 304, 314, 400
HphI GGTGA 2 cut(s) 299, 313
Hpy188I TCNGA 2 cut(s) 229, 533
Hpy188III TCNNGA 4 cut(s) 190, 320, 397, 430
Hpy99I CGWCG 1 cut(s) 398
HpyAV CCTTC 1 cut(s) 364
HpyCH4V TGCA 3 cut(s) 87, 200, 439
HpyF10VI GCNNNNNNNGC 3 cut(s) 163, 221, 230
HpyF3I CTNAG 3 cut(s) 72, 102, 443
Hsp92II CATG 7 cut(s) 91, 110, 145, 215, 352, 412, 520
Kzo9I GATC 1 cut(s) 494
LpnPI CCDG 9 cut(s) 170, 252, 267, 279, 284, 296, 305, 323, 443
LweI GCATC 1 cut(s) 88
MaeIII GTNAC 1 cut(s) 305
MalI GATC 1 cut(s) 496
MboI GATC 1 cut(s) 494
MboII GAAGA 5 cut(s) 16, 125, 136, 484, 487
MhlI GDGCHC 1 cut(s) 266
MluCI AATT 5 cut(s) 246, 287, 451, 478, 534
MlyI GAGTC 1 cut(s) 313
MmeI TCCRAC 2 cut(s) 317, 385
MnlI CCTC 5 cut(s) 72, 75, 109, 261, 316
MseI TTAA 4 cut(s) 168, 273, 333, 354
MslI CAYNNNNRTG 1 cut(s) 146
MspR9I CCNGG 2 cut(s) 267, 311
MvaI CCWGG 2 cut(s) 267, 311
MwoI GCNNNNNNNGC 3 cut(s) 163, 221, 230
NcoI CCATGG 3 cut(s) 348, 408, 516
NdeII GATC 1 cut(s) 494
NlaIII CATG 7 cut(s) 91, 110, 145, 215, 352, 412, 520
NlaIV GGNNCC 2 cut(s) 43, 264
NmuCI GTSAC 1 cut(s) 305
NspI RCATGY 2 cut(s) 91, 110
PaeI GCATGC 1 cut(s) 91
PfeI GAWTC 3 cut(s) 152, 314, 400
PleI GAGTC 1 cut(s) 312
PpsI GAGTC 1 cut(s) 312
Psp6I CCWGG 2 cut(s) 265, 309
PspGI CCWGG 2 cut(s) 265, 309
PspN4I GGNNCC 2 cut(s) 43, 264
PspOMI GGGCCC 1 cut(s) 262
PspPI GGNCC 2 cut(s) 262, 263
RseI CAYNNNNRTG 1 cut(s) 146
SaqAI TTAA 4 cut(s) 168, 273, 333, 354
Sau3AI GATC 1 cut(s) 494
Sau96I GGNCC 2 cut(s) 262, 263
SchI GAGTC 1 cut(s) 313
ScrFI CCNGG 2 cut(s) 267, 311
SduI GDGCHC 1 cut(s) 266
SetI ASST 9 cut(s) 54, 168, 186, 198, 235, 286, 333, 375, 529
SfaNI GCATC 1 cut(s) 88
SmiMI CAYNNNNRTG 1 cut(s) 146
SphI GCATGC 1 cut(s) 91
Sse9I AATT 5 cut(s) 246, 287, 451, 478, 534
StyD4I CCNGG 2 cut(s) 265, 309
StyI CCWWGG 3 cut(s) 348, 408, 516
TasI AATT 5 cut(s) 246, 287, 451, 478, 534
TfiI GAWTC 3 cut(s) 152, 314, 400
Tru1I TTAA 4 cut(s) 168, 273, 333, 354
Tru9I TTAA 4 cut(s) 168, 273, 333, 354
TscAI CASTG 2 cut(s) 43, 451
TseFI GTSAC 1 cut(s) 305
Tsp45I GTSAC 1 cut(s) 305
TspDTI ATGAA 2 cut(s) 17, 351
TspGWI ACGGA 1 cut(s) 34
TspRI CASTG 2 cut(s) 43, 451
XapI RAATTY 3 cut(s) 246, 287, 534
XceI RCATGY 2 cut(s) 91, 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.