Rroxscaffold_1G00036410

Belongs to the universal ribosomal protein uL1 family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
53188437 .. 53190487
2051 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00036410.1

Sequence Viewer

Length: 333 bp
ATGCCTTTTTTAGCATCAGAAGCTGTTATCAAGCAGATTCCCCGTCTTTTGGGTCCTGGTCTCAACAAGGCAGGAAAGTTCCCAACCCTTGTTTCTCACCAAGAATCCCTGGAGTCTAAAATTTCTGAGACAAAAGCAACAATTAAGTTCCAATTGAAGAAGGTTCTTTGCATGGGAGTTGCTGTAGGGAATGTCTCAATGGAGGAGAAGCAAATCTTCCAAAATGTGCAATTGAGCGTCAACTTTCTTGTTTCACTATTGAAAAAAAATTGGCAAAATGTGAAGTGCTTGAACCTGAAGACCACTATGGGGAAGCCATATCGCATTTATTAG

Protein Analysis

110

Amino Acids

12.35

Weight (kDa)

9.91

Isoelectric Point (pI)

26.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L1 PF00687 3 - 104 1e-27 Ribosomal protein L1p/L10e family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 120
AcuI CTGAAG 1 cut(s) 317
AfiI CCNNNNNNNGG 2 cut(s) 49, 309
AgsI TTSAA 3 cut(s) 157, 262, 292
AjnI CCWGG 2 cut(s) 55, 108
AjuI GAANNNNNNNTTGG 2 cut(s) 76, 108
AluBI AGCT 1 cut(s) 23
AluI AGCT 1 cut(s) 23
Alw26I GTCTC 3 cut(s) 65, 122, 199
AlwNI CAGNNNCTG 1 cut(s) 23
ApoI RAATTY 1 cut(s) 120
AspS9I GGNCC 1 cut(s) 53
AsuHPI GGTGA 1 cut(s) 89
AvaII GGWCC 1 cut(s) 53
BbsI GAAGAC 1 cut(s) 305
BciT130I CCWGG 2 cut(s) 57, 110
BcoDI GTCTC 3 cut(s) 65, 122, 199
BfmI CTRYAG 1 cut(s) 183
Bme1390I CCNGG 2 cut(s) 57, 110
Bme18I GGWCC 1 cut(s) 53
BmgT120I GGNCC 1 cut(s) 53
BmiI GGNNCC 1 cut(s) 54
BmrFI CCNGG 2 cut(s) 57, 110
BmsI GCATC 1 cut(s) 23
BpiI GAAGAC 1 cut(s) 305
BpmI CTGGAG 1 cut(s) 131
BsaI GGTCTC 1 cut(s) 65
BsaJI CCNNGG 1 cut(s) 108
BsaXI ACNNNNNCTCC 2 cut(s) 168, 198
Bsc4I CCNNNNNNNGG 2 cut(s) 49, 309
BseBI CCWGG 2 cut(s) 57, 110
BseDI CCNNGG 1 cut(s) 108
BseLI CCNNNNNNNGG 2 cut(s) 49, 309
BseMII CTCAG 1 cut(s) 117
BseRI GAGGAG 1 cut(s) 218
BslI CCNNNNNNNGG 2 cut(s) 49, 309
BsmAI GTCTC 3 cut(s) 65, 122, 199
Bso31I GGTCTC 1 cut(s) 65
BspCNI CTCAG 1 cut(s) 118
BspLI GGNNCC 1 cut(s) 54
BspTNI GGTCTC 1 cut(s) 65
BssECI CCNNGG 1 cut(s) 108
Bst2UI CCWGG 2 cut(s) 57, 110
BstDEI CTNAG 1 cut(s) 126
BstMAI GTCTC 3 cut(s) 65, 122, 199
BstMWI GCNNNNNNNGC 1 cut(s) 20
BstNI CCWGG 2 cut(s) 57, 110
BstSCI CCNGG 2 cut(s) 55, 108
BstSFI CTRYAG 1 cut(s) 183
BstV2I GAAGAC 1 cut(s) 305
CaiI CAGNNNCTG 1 cut(s) 23
Cfr13I GGNCC 1 cut(s) 53
CseI GACGC 1 cut(s) 226
CviAII CATG 1 cut(s) 172
CviJI RGCY 2 cut(s) 23, 316
CviKI_1 RGCY 2 cut(s) 23, 316
DdeI CTNAG 1 cut(s) 126
Eco31I GGTCTC 1 cut(s) 65
Eco47I GGWCC 1 cut(s) 53
Eco57I CTGAAG 1 cut(s) 317
EcoO109I RGGNCCY 1 cut(s) 53
EcoRII CCWGG 2 cut(s) 55, 108
FaeI CATG 1 cut(s) 175
FaiI YATR 3 cut(s) 173, 308, 319
FalI AAGNNNNNCTT 2 cut(s) 200, 232
FatI CATG 1 cut(s) 171
GsuI CTGGAG 1 cut(s) 131
HgaI GACGC 1 cut(s) 226
Hin1II CATG 1 cut(s) 175
HincII GTYRAC 1 cut(s) 241
HindII GTYRAC 1 cut(s) 241
HinfI GANTC 3 cut(s) 37, 104, 113
HphI GGTGA 1 cut(s) 89
Hpy166II GTNNAC 1 cut(s) 241
Hpy188I TCNGA 2 cut(s) 19, 127
Hpy8I GTNNAC 1 cut(s) 241
HpyAV CCTTC 1 cut(s) 154
HpyCH4V TGCA 2 cut(s) 171, 229
HpyF10VI GCNNNNNNNGC 1 cut(s) 20
HpyF3I CTNAG 1 cut(s) 126
Hsp92II CATG 1 cut(s) 175
LpnPI CCDG 6 cut(s) 42, 57, 69, 95, 122, 308
LweI GCATC 1 cut(s) 23
MboII GAAGA 3 cut(s) 169, 208, 310
MfeI CAATTG 2 cut(s) 152, 230
MluCI AATT 5 cut(s) 120, 141, 152, 230, 268
MlyI GAGTC 1 cut(s) 122
MnlI CCTC 1 cut(s) 196
MseI TTAA 1 cut(s) 144
MspR9I CCNGG 2 cut(s) 57, 110
MunI CAATTG 2 cut(s) 152, 230
MvaI CCWGG 2 cut(s) 57, 110
MwoI GCNNNNNNNGC 1 cut(s) 20
NlaIII CATG 1 cut(s) 175
NlaIV GGNNCC 1 cut(s) 54
PfeI GAWTC 2 cut(s) 37, 104
PleI GAGTC 1 cut(s) 121
PpsI GAGTC 1 cut(s) 121
PpuMI RGGWCCY 1 cut(s) 53
Psp5II RGGWCCY 1 cut(s) 53
Psp6I CCWGG 2 cut(s) 55, 108
PspGI CCWGG 2 cut(s) 55, 108
PspN4I GGNNCC 1 cut(s) 54
PspPI GGNCC 1 cut(s) 53
PspPPI RGGWCCY 1 cut(s) 53
PstNI CAGNNNCTG 1 cut(s) 23
SaqAI TTAA 1 cut(s) 144
Sau96I GGNCC 1 cut(s) 53
SchI GAGTC 1 cut(s) 122
ScrFI CCNGG 2 cut(s) 57, 110
SetI ASST 3 cut(s) 25, 165, 297
SfaNI GCATC 1 cut(s) 23
SfcI CTRYAG 1 cut(s) 183
SinI GGWCC 1 cut(s) 53
Sse9I AATT 5 cut(s) 120, 141, 152, 230, 268
StyD4I CCNGG 2 cut(s) 55, 108
TasI AATT 5 cut(s) 120, 141, 152, 230, 268
TfiI GAWTC 2 cut(s) 37, 104
Tru1I TTAA 1 cut(s) 144
Tru9I TTAA 1 cut(s) 144
VpaK11BI GGWCC 1 cut(s) 53
XapI RAATTY 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.