Rmu_sc0003439.1_g000011

Cytochrome p450

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003439.1
Physical Location & Seq
Forward (+)
42811 .. 43115
305 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003439.1_g000011.1.cds

Sequence Viewer

Length: 204 bp
atgtgcaagagattcactccctttggtggagggtctagatgctgtccaggatctgaacttgggaggcttgaggttgcattttttctccaccaccttgtacaaaatttcaggtggaggactgaggatgatgagcaacctatagcttatccgtacgtagaattcaaaagagggttgccactttacttggaggattgccccatttga

Protein Analysis

67

Amino Acids

7.84

Weight (kDa)

6.05

Isoelectric Point (pI)

59.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 58
AcsI RAATTY 2 cut(s) 103, 158
AfaI GTAC 2 cut(s) 99, 152
AfiI CCNNNNNNNGG 1 cut(s) 26
AgsI TTSAA 1 cut(s) 163
AjnI CCWGG 1 cut(s) 46
AluBI AGCT 1 cut(s) 143
AluI AGCT 1 cut(s) 143
AlwI GGATC 1 cut(s) 58
AlwNI CAGNNNCTG 1 cut(s) 53
ApoI RAATTY 2 cut(s) 103, 158
BciT130I CCWGG 1 cut(s) 48
BfaI CTAG 1 cut(s) 36
BfmI CTRYAG 1 cut(s) 138
Bme1390I CCNGG 1 cut(s) 48
BmrFI CCNGG 1 cut(s) 48
BmsI GCATC 1 cut(s) 29
BplI GAGNNNNNCTC 1 cut(s) 33
BpuEI CTTGAG 1 cut(s) 89
BsaAI YACGTR 1 cut(s) 154
Bsc4I CCNNNNNNNGG 1 cut(s) 26
BseBI CCWGG 1 cut(s) 48
BseGI GGATG 1 cut(s) 130
BseLI CCNNNNNNNGG 1 cut(s) 26
BseMII CTCAG 1 cut(s) 111
BsiWI CGTACG 1 cut(s) 150
BslI CCNNNNNNNGG 1 cut(s) 26
Bsp1407I TGTACA 1 cut(s) 97
Bsp143I GATC 1 cut(s) 50
BspCNI CTCAG 1 cut(s) 112
BspPI GGATC 1 cut(s) 58
BsrGI TGTACA 1 cut(s) 97
BssMI GATC 1 cut(s) 50
Bst2UI CCWGG 1 cut(s) 48
BstAUI TGTACA 1 cut(s) 97
BstBAI YACGTR 1 cut(s) 154
BstDEI CTNAG 1 cut(s) 120
BstF5I GGATG 1 cut(s) 130
BstKTI GATC 1 cut(s) 53
BstMBI GATC 1 cut(s) 50
BstNI CCWGG 1 cut(s) 48
BstSCI CCNGG 1 cut(s) 46
BstSFI CTRYAG 1 cut(s) 138
BstSNI TACGTA 1 cut(s) 154
BstX2I RGATCY 1 cut(s) 50
BstYI RGATCY 1 cut(s) 50
BtsCI GGATG 1 cut(s) 130
CaiI CAGNNNCTG 1 cut(s) 53
Csp6I GTAC 2 cut(s) 98, 151
CspCI CAANNNNNGTGG 2 cut(s) 165, 200
CviJI RGCY 2 cut(s) 67, 143
CviKI_1 RGCY 2 cut(s) 67, 143
CviQI GTAC 2 cut(s) 98, 151
DdeI CTNAG 1 cut(s) 120
DpnI GATC 1 cut(s) 52
DpnII GATC 1 cut(s) 50
Eco105I TACGTA 1 cut(s) 154
EcoRI GAATTC 1 cut(s) 158
EcoRII CCWGG 1 cut(s) 46
FaiI YATR 1 cut(s) 140
FokI GGATG 1 cut(s) 137
FspBI CTAG 1 cut(s) 36
HinfI GANTC 1 cut(s) 12
Hpy188I TCNGA 1 cut(s) 55
Hpy188III TCNNGA 1 cut(s) 36
HpyCH4IV ACGT 1 cut(s) 153
HpyCH4V TGCA 2 cut(s) 6, 77
HpyF3I CTNAG 1 cut(s) 120
HpySE526I ACGT 1 cut(s) 153
Kzo9I GATC 1 cut(s) 50
LpnPI CCDG 3 cut(s) 33, 60, 94
LweI GCATC 1 cut(s) 29
MaeI CTAG 1 cut(s) 36
MaeII ACGT 1 cut(s) 153
MalI GATC 1 cut(s) 52
MboI GATC 1 cut(s) 50
MflI RGATCY 1 cut(s) 50
MluCI AATT 2 cut(s) 103, 158
MnlI CCTC 7 cut(s) 23, 57, 64, 108, 115, 161, 181
MspR9I CCNGG 1 cut(s) 48
MvaI CCWGG 1 cut(s) 48
NdeII GATC 1 cut(s) 50
PfeI GAWTC 1 cut(s) 12
Pfl23II CGTACG 1 cut(s) 150
PfoI TCCNGGA 1 cut(s) 46
Ppu21I YACGTR 1 cut(s) 154
Psp6I CCWGG 1 cut(s) 46
PspGI CCWGG 1 cut(s) 46
PspLI CGTACG 1 cut(s) 150
PstNI CAGNNNCTG 1 cut(s) 53
PsuI RGATCY 1 cut(s) 50
RsaI GTAC 2 cut(s) 99, 152
RsaNI GTAC 2 cut(s) 98, 151
Sau3AI GATC 1 cut(s) 50
ScrFI CCNGG 1 cut(s) 48
SetI ASST 6 cut(s) 75, 96, 113, 139, 145, 156
SfaNI GCATC 1 cut(s) 29
SfcI CTRYAG 1 cut(s) 138
SgeI CNNG 9 cut(s) 19, 48, 59, 60, 71, 80, 107, 121, 196
SmlI CTYRAG 1 cut(s) 68
SmoI CTYRAG 1 cut(s) 68
SnaBI TACGTA 1 cut(s) 154
Sse9I AATT 2 cut(s) 103, 158
SspMI CTAG 1 cut(s) 36
StyD4I CCNGG 1 cut(s) 46
TaiI ACGT 1 cut(s) 156
TasI AATT 2 cut(s) 103, 158
TatI WGTACW 1 cut(s) 97
TfiI GAWTC 1 cut(s) 12
TspGWI ACGGA 1 cut(s) 138
XapI RAATTY 2 cut(s) 103, 158
XbaI TCTAGA 1 cut(s) 35
XspI CTAG 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.