Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003829.1

Orthogroup ID

OG0003324

Physical Location & Seq

Genomic Coordinates Reverse (-)

73938 .. 75072

Gene Structure 1135 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003829.1_g000022.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 309 bp

atgttaagtcacttgaagcgccagcctaggaacaaggagcgccgtgttgcatggcttcgttacgtagagccactttttaatggtgttggtctggtgttactagctcatttcaggcgcattttccctcttttctttaagtggaagcaagctgatgacgatgagactgttttactgtgttctattaatgctctttggtgcttggatgagctgagcttttgcaaaggaggtgaagaatttctttctctattttggatgatgtttcacatgtattggggatttgaggctggggtggaattggaaaagcagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

102

Amino Acids

12.27

Weight (kDa)

6.82

Isoelectric Point (pI)

43.75

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003324)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G39910
fragaria_vesca	FvH4_7g23870
malus_domestica	MD07G1212900.v1.1
prunus_persica	Prupe.2G245100_v2.0.a1 Prupe.2G245100_v2.0.a1
pyrus_communis	pycom07g19570
rosa_chinensis	RchiOBHm_Chr1g0339731 RchiOBHm_Chr1g0369221 RchiOBHm_Chr2g0110551
rosa_laevigata	RLG00000001778 RLG00000001837 RLG00000015598 RLG00000027144 RLG00000034738
rosa_multiflora	Rmu_sc0003829.1_g000022 Rmu_sc0004775.1_g000002 Rmu_sc0005807.1_g000001 Rmu_sc0008053.1_g000032
rosa_roxburghii	Rroxscaffold_4G00287840 Rroxscaffold_6G00396450 Rroxscaffold_6G00412170
rosa_rugosa	Rorug01G0349200 Rorug04G0051800 Rorug05G0139700 Rorug07G0313200
rosa_samantha	Rh1AG356100 Rh1BG319700 Rh1CG060000 Rh1CG333700 Rh1DG064000 Rh1DG350400 Rh2CG222300 Rh5CG068700 Rh7BG045300
rosa_wichuraiana	Rw1G031430 Rw7G029140

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	233
AflIII	ACRYGT	1 cut(s)	264
AgsI	TTSAA	1 cut(s)	16
AluBI	AGCT	4 cut(s)	104, 149, 208, 213
AluI	AGCT	4 cut(s)	104, 149, 208, 213
Alw26I	GTCTC	1 cut(s)	155
ApoI	RAATTY	1 cut(s)	233
AseI	ATTAAT	1 cut(s)	183
Asp700I	GAANNNNTTC	1 cut(s)	234
AspA2I	CCTAGG	1 cut(s)	26
AspLEI	GCGC	3 cut(s)	21, 42, 117
AsuHPI	GGTGA	1 cut(s)	239
AvrII	CCTAGG	1 cut(s)	26
BceAI	ACGGC	1 cut(s)	27
BcoDI	GTCTC	1 cut(s)	155
BfaI	CTAG	2 cut(s)	27, 101
BfoI	RGCGCY	2 cut(s)	22, 43
BlnI	CCTAGG	1 cut(s)	26
BlpI	GCTNAGC	1 cut(s)	209
Bpu1102I	GCTNAGC	1 cut(s)	209
BsaAI	YACGTR	1 cut(s)	64
BsaJI	CCNNGG	1 cut(s)	26
BseDI	CCNNGG	1 cut(s)	26
BseGI	GGATG	2 cut(s)	208, 258
BseMII	CTCAG	1 cut(s)	200
BseYI	CCCAGC	1 cut(s)	284
BsmAI	GTCTC	1 cut(s)	155
Bsp1720I	GCTNAGC	1 cut(s)	209
BspCNI	CTCAG	1 cut(s)	201
BssECI	CCNNGG	1 cut(s)	26
BssT1I	CCWWGG	1 cut(s)	26
Bst4CI	ACNGT	2 cut(s)	166, 174
BstBAI	YACGTR	1 cut(s)	64
BstC8I	GCNNGC	2 cut(s)	23, 147
BstDEI	CTNAG	1 cut(s)	209
BstF5I	GGATG	2 cut(s)	208, 258
BstH2I	RGCGCY	2 cut(s)	22, 43
BstHHI	GCGC	3 cut(s)	21, 42, 117
BstMAI	GTCTC	1 cut(s)	155
BstNSI	RCATGY	1 cut(s)	268
BstSNI	TACGTA	1 cut(s)	64
BtsCI	GGATG	2 cut(s)	208, 258
Cac8I	GCNNGC	2 cut(s)	23, 147
CfoI	GCGC	3 cut(s)	21, 42, 117
CviAII	CATG	2 cut(s)	51, 265
CviJI	RGCY	8 cut(s)	25, 55, 70, 104, 149, 208, 213, 284
CviKI_1	RGCY	8 cut(s)	25, 55, 70, 104, 149, 208, 213, 284
DdeI	CTNAG	1 cut(s)	209
Eco105I	TACGTA	1 cut(s)	64
Eco130I	CCWWGG	1 cut(s)	26
EcoT14I	CCWWGG	1 cut(s)	26
ErhI	CCWWGG	1 cut(s)	26
FaeI	CATG	2 cut(s)	54, 268
FaiI	YATR	2 cut(s)	52, 266
FalI	AAGNNNNNCTT	2 cut(s)	222, 254
FatI	CATG	2 cut(s)	50, 264
FokI	GGATG	2 cut(s)	215, 265
FspBI	CTAG	2 cut(s)	27, 101
GlaI	GCGC	3 cut(s)	20, 41, 116
GsaI	CCCAGC	1 cut(s)	288
HaeII	RGCGCY	2 cut(s)	22, 43
HhaI	GCGC	3 cut(s)	21, 42, 117
Hin1II	CATG	2 cut(s)	54, 268
Hin6I	GCGC	3 cut(s)	19, 40, 115
HinP1I	GCGC	3 cut(s)	19, 40, 115
HphI	GGTGA	1 cut(s)	239
HpyCH4III	ACNGT	2 cut(s)	166, 174
HpyCH4IV	ACGT	1 cut(s)	63
HpyCH4V	TGCA	2 cut(s)	50, 219
HpyF3I	CTNAG	1 cut(s)	209
HpySE526I	ACGT	1 cut(s)	63
Hsp92II	CATG	2 cut(s)	54, 268
HspAI	GCGC	3 cut(s)	19, 40, 115
LmnI	GCTCC	1 cut(s)	37
LpnPI	CCDG	4 cut(s)	35, 77, 97, 270
MaeI	CTAG	2 cut(s)	27, 101
MaeII	ACGT	1 cut(s)	63
MaeIII	GTNAC	3 cut(s)	8, 59, 96
MboII	GAAGA	1 cut(s)	242
MluCI	AATT	2 cut(s)	233, 293
MnlI	CCTC	3 cut(s)	135, 218, 274
MroXI	GAANNNNTTC	1 cut(s)	234
MseI	TTAA	4 cut(s)	5, 78, 135, 183
NlaIII	CATG	2 cut(s)	54, 268
NmuCI	GTSAC	1 cut(s)	8
NspI	RCATGY	1 cut(s)	268
PciI	ACATGT	1 cut(s)	264
PdmI	GAANNNNTTC	1 cut(s)	234
Ppu21I	YACGTR	1 cut(s)	64
PscI	ACATGT	1 cut(s)	264
PshBI	ATTAAT	1 cut(s)	183
PspFI	CCCAGC	1 cut(s)	284
SaqAI	TTAA	4 cut(s)	5, 78, 135, 183
SetI	ASST	6 cut(s)	66, 106, 151, 210, 215, 229
SnaBI	TACGTA	1 cut(s)	64
Sse9I	AATT	2 cut(s)	233, 293
SspMI	CTAG	2 cut(s)	27, 101
StyI	CCWWGG	1 cut(s)	26
TaaI	ACNGT	2 cut(s)	166, 174
TaiI	ACGT	1 cut(s)	66
TasI	AATT	2 cut(s)	233, 293
Tru1I	TTAA	4 cut(s)	5, 78, 135, 183
Tru9I	TTAA	4 cut(s)	5, 78, 135, 183
TseFI	GTSAC	1 cut(s)	8
Tsp45I	GTSAC	1 cut(s)	8
VspI	ATTAAT	1 cut(s)	183
XapI	RAATTY	1 cut(s)	233
XceI	RCATGY	1 cut(s)	268
XmaJI	CCTAGG	1 cut(s)	26
XmnI	GAANNNNTTC	1 cut(s)	234
XspI	CTAG	2 cut(s)	27, 101

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.